Incidental Mutation 'R9176:Mertk'
ID 696656
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Name c-mer proto-oncogene tyrosine kinase
Synonyms Nyk, nmf12, Tyro 12, Eyk, Mer
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128698956-128802894 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128778972 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 578 (D578G)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
AlphaFold Q60805
Predicted Effect possibly damaging
Transcript: ENSMUST00000014505
AA Change: D578G

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: D578G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,194 D119G probably damaging Het
1700123K08Rik T C 5: 138,562,893 D169G probably damaging Het
4932438A13Rik T A 3: 36,956,703 V1750E possibly damaging Het
Abcd2 T G 15: 91,191,420 R63S probably benign Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Avil T C 10: 127,016,379 Y678H probably damaging Het
Cd300ld2 C A 11: 115,013,946 E32* probably null Het
Chuk A T 19: 44,088,003 L423Q probably damaging Het
Cisd3 A G 11: 97,688,301 T90A probably damaging Het
Cmpk2 T A 12: 26,474,028 S275T probably benign Het
Cntnap5c T A 17: 58,313,735 N936K probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col4a4 G T 1: 82,485,628 P1047Q unknown Het
Col6a4 A G 9: 106,061,556 L1321P probably damaging Het
Crat A G 2: 30,407,880 F211L probably damaging Het
Csmd3 T C 15: 48,001,541 Q27R Het
Dapk1 T C 13: 60,718,448 V205A probably damaging Het
Ddx20 T C 3: 105,678,842 N729S probably benign Het
Derl2 A G 11: 71,013,550 V139A possibly damaging Het
Dscam C T 16: 96,685,353 D1041N probably benign Het
E2f4 TAGCAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG TAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG 8: 105,301,368 probably benign Het
Fam160b2 T C 14: 70,589,100 K183E probably benign Het
Fbxo2 A T 4: 148,165,690 R226W probably damaging Het
Gm4070 T C 7: 105,902,055 K597E possibly damaging Het
Gpr19 A G 6: 134,869,755 S322P probably damaging Het
Herc6 A G 6: 57,659,678 N793S probably benign Het
Ikbke A T 1: 131,263,288 S563T probably benign Het
Il1r2 T C 1: 40,105,318 L55P probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Lims1 T G 10: 58,418,443 C340G probably damaging Het
Loxl3 G A 6: 83,049,311 C460Y probably damaging Het
Mapk9 T A 11: 49,872,738 L152* probably null Het
Mef2d T C 3: 88,159,156 V144A possibly damaging Het
Mettl1 C A 10: 127,045,381 Q254K probably benign Het
Naip2 T C 13: 100,162,199 E443G probably damaging Het
Ndor1 A G 2: 25,248,229 F484L probably damaging Het
Neurl1b C T 17: 26,441,081 T425I possibly damaging Het
Nomo1 G A 7: 46,081,404 V1104M possibly damaging Het
Olfr1257 T C 2: 89,881,171 V115A probably benign Het
Olfr1340 T A 4: 118,726,653 Y135* probably null Het
Olfr1443 A G 19: 12,680,236 M43V probably benign Het
Olfr1501 A G 19: 13,838,432 V247A probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr480 A G 7: 108,066,039 V223A probably benign Het
Olfr525 G T 7: 140,323,208 G170C probably damaging Het
Parp4 A G 14: 56,635,817 K1173E possibly damaging Het
Phkb T A 8: 85,970,994 N477K probably damaging Het
Plekha7 T G 7: 116,140,691 I812L possibly damaging Het
Plxnb1 A G 9: 109,112,583 T1711A probably damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Pomt2 T A 12: 87,147,677 probably benign Het
Prdm1 T C 10: 44,440,127 H671R probably damaging Het
Prkca G A 11: 107,979,418 R15C possibly damaging Het
Prkch T A 12: 73,700,194 N282K probably damaging Het
Ptpn6 T C 6: 124,725,286 R385G probably benign Het
Rad21 A T 15: 51,978,059 M87K probably damaging Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Scn1a A T 2: 66,273,345 V1857E probably damaging Het
Shprh A G 10: 11,160,576 T386A probably benign Het
Slco1b2 T C 6: 141,652,503 L94P probably damaging Het
Snx29 A G 16: 11,418,864 N90D probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tbc1d5 T C 17: 50,782,335 T584A probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tpp2 A G 1: 43,992,393 N1124D probably null Het
Trpv1 A T 11: 73,239,655 T196S probably benign Het
Ulk4 T C 9: 121,145,062 E968G probably benign Het
Zbtb8a G T 4: 129,360,428 T91K probably damaging Het
Zfp317 T A 9: 19,647,867 V459E probably damaging Het
Zfp790 A G 7: 29,829,962 T691A probably benign Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
R8953:Mertk UTSW 2 128778796 intron probably benign
R9135:Mertk UTSW 2 128762115 missense probably benign 0.23
R9153:Mertk UTSW 2 128782567 missense probably damaging 1.00
R9443:Mertk UTSW 2 128762109 missense probably benign 0.00
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGTATAAGTTGGGCAAGTG -3'
(R):5'- TGCCTCTTACATATGTCAGATCTG -3'

Sequencing Primer
(F):5'- GGCAAGTGTGTTACTCTGAAC -3'
(R):5'- GTCAGATCTGAGTTTCAAAATTCTCC -3'
Posted On 2022-02-07