Incidental Mutation 'R9176:Prkch'
ID 696700
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Name protein kinase C, eta
Synonyms Pkch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73584796-73778185 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73700194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 282 (N282K)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527] [ENSMUST00000221153]
AlphaFold P23298
Predicted Effect probably damaging
Transcript: ENSMUST00000021527
AA Change: N282K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: N282K

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221153
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,194 D119G probably damaging Het
1700123K08Rik T C 5: 138,562,893 D169G probably damaging Het
4932438A13Rik T A 3: 36,956,703 V1750E possibly damaging Het
Abcd2 T G 15: 91,191,420 R63S probably benign Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Avil T C 10: 127,016,379 Y678H probably damaging Het
Cd300ld2 C A 11: 115,013,946 E32* probably null Het
Chuk A T 19: 44,088,003 L423Q probably damaging Het
Cisd3 A G 11: 97,688,301 T90A probably damaging Het
Cmpk2 T A 12: 26,474,028 S275T probably benign Het
Cntnap5c T A 17: 58,313,735 N936K probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col4a4 G T 1: 82,485,628 P1047Q unknown Het
Col6a4 A G 9: 106,061,556 L1321P probably damaging Het
Crat A G 2: 30,407,880 F211L probably damaging Het
Csmd3 T C 15: 48,001,541 Q27R Het
Dapk1 T C 13: 60,718,448 V205A probably damaging Het
Ddx20 T C 3: 105,678,842 N729S probably benign Het
Derl2 A G 11: 71,013,550 V139A possibly damaging Het
Dscam C T 16: 96,685,353 D1041N probably benign Het
E2f4 TAGCAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG TAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG 8: 105,301,368 probably benign Het
Fam160b2 T C 14: 70,589,100 K183E probably benign Het
Fbxo2 A T 4: 148,165,690 R226W probably damaging Het
Gm4070 T C 7: 105,902,055 K597E possibly damaging Het
Gpr19 A G 6: 134,869,755 S322P probably damaging Het
Herc6 A G 6: 57,659,678 N793S probably benign Het
Ikbke A T 1: 131,263,288 S563T probably benign Het
Il1r2 T C 1: 40,105,318 L55P probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Lims1 T G 10: 58,418,443 C340G probably damaging Het
Loxl3 G A 6: 83,049,311 C460Y probably damaging Het
Mapk9 T A 11: 49,872,738 L152* probably null Het
Mef2d T C 3: 88,159,156 V144A possibly damaging Het
Mertk A G 2: 128,778,972 D578G possibly damaging Het
Mettl1 C A 10: 127,045,381 Q254K probably benign Het
Naip2 T C 13: 100,162,199 E443G probably damaging Het
Ndor1 A G 2: 25,248,229 F484L probably damaging Het
Neurl1b C T 17: 26,441,081 T425I possibly damaging Het
Nomo1 G A 7: 46,081,404 V1104M possibly damaging Het
Olfr1257 T C 2: 89,881,171 V115A probably benign Het
Olfr1340 T A 4: 118,726,653 Y135* probably null Het
Olfr1443 A G 19: 12,680,236 M43V probably benign Het
Olfr1501 A G 19: 13,838,432 V247A probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr480 A G 7: 108,066,039 V223A probably benign Het
Olfr525 G T 7: 140,323,208 G170C probably damaging Het
Parp4 A G 14: 56,635,817 K1173E possibly damaging Het
Phkb T A 8: 85,970,994 N477K probably damaging Het
Plekha7 T G 7: 116,140,691 I812L possibly damaging Het
Plxnb1 A G 9: 109,112,583 T1711A probably damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Pomt2 T A 12: 87,147,677 probably benign Het
Prdm1 T C 10: 44,440,127 H671R probably damaging Het
Prkca G A 11: 107,979,418 R15C possibly damaging Het
Ptpn6 T C 6: 124,725,286 R385G probably benign Het
Rad21 A T 15: 51,978,059 M87K probably damaging Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Scn1a A T 2: 66,273,345 V1857E probably damaging Het
Shprh A G 10: 11,160,576 T386A probably benign Het
Slco1b2 T C 6: 141,652,503 L94P probably damaging Het
Snx29 A G 16: 11,418,864 N90D probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tbc1d5 T C 17: 50,782,335 T584A probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tpp2 A G 1: 43,992,393 N1124D probably null Het
Trpv1 A T 11: 73,239,655 T196S probably benign Het
Ulk4 T C 9: 121,145,062 E968G probably benign Het
Zbtb8a G T 4: 129,360,428 T91K probably damaging Het
Zfp317 T A 9: 19,647,867 V459E probably damaging Het
Zfp790 A G 7: 29,829,962 T691A probably benign Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
wolfcreek UTSW 12 73759710 missense probably damaging 1.00
G1Funyon:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8294:Prkch UTSW 12 73759710 missense probably damaging 1.00
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
R8734:Prkch UTSW 12 73585244 missense possibly damaging 0.62
R8766:Prkch UTSW 12 73702538 missense probably benign 0.01
R8998:Prkch UTSW 12 73696199 missense probably damaging 1.00
R8999:Prkch UTSW 12 73696199 missense probably damaging 1.00
R9058:Prkch UTSW 12 73775534 critical splice donor site probably null
R9152:Prkch UTSW 12 73691644 missense possibly damaging 0.91
R9194:Prkch UTSW 12 73721842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCTGCTATTCTTTCATGC -3'
(R):5'- ATTTGAGCTCATTGCACCGG -3'

Sequencing Primer
(F):5'- TCTGCCTCTGCACTAATCAGAAG -3'
(R):5'- GAGCTCATTGCACCGGAATAACTTG -3'
Posted On 2022-02-07