Incidental Mutation 'R9176:Naip2'
ID 696703
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene Name NLR family, apoptosis inhibitory protein 2
Synonyms Naip-rs6, Birc1b, Naip2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9176 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 100280571-100338600 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100298707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 443 (E443G)
Ref Sequence ENSEMBL: ENSMUSP00000070827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
AlphaFold Q9QUK4
Predicted Effect probably damaging
Transcript: ENSMUST00000067975
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: E443G

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117913
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: E443G

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167986
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: E443G

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,121,004 (GRCm39) D119G probably damaging Het
1700123K08Rik T C 5: 138,561,155 (GRCm39) D169G probably damaging Het
Abcd2 T G 15: 91,075,623 (GRCm39) R63S probably benign Het
Ankrd55 T C 13: 112,459,610 (GRCm39) V68A possibly damaging Het
Avil T C 10: 126,852,248 (GRCm39) Y678H probably damaging Het
Bltp1 T A 3: 37,010,852 (GRCm39) V1750E possibly damaging Het
Cd300ld2 C A 11: 114,904,772 (GRCm39) E32* probably null Het
Chuk A T 19: 44,076,442 (GRCm39) L423Q probably damaging Het
Cisd3 A G 11: 97,579,127 (GRCm39) T90A probably damaging Het
Cmpk2 T A 12: 26,524,027 (GRCm39) S275T probably benign Het
Cntnap5c T A 17: 58,620,730 (GRCm39) N936K probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Col4a4 G T 1: 82,463,349 (GRCm39) P1047Q unknown Het
Col6a4 A G 9: 105,938,755 (GRCm39) L1321P probably damaging Het
Crat A G 2: 30,297,892 (GRCm39) F211L probably damaging Het
Csmd3 T C 15: 47,864,937 (GRCm39) Q27R Het
Dapk1 T C 13: 60,866,262 (GRCm39) V205A probably damaging Het
Ddx20 T C 3: 105,586,158 (GRCm39) N729S probably benign Het
Derl2 A G 11: 70,904,376 (GRCm39) V139A possibly damaging Het
Dscam C T 16: 96,486,553 (GRCm39) D1041N probably benign Het
Fbxo2 A T 4: 148,250,147 (GRCm39) R226W probably damaging Het
Fhip1b A C 7: 105,030,585 (GRCm39) H180Q probably benign Het
Fhip2b T C 14: 70,826,540 (GRCm39) K183E probably benign Het
Gpr19 A G 6: 134,846,718 (GRCm39) S322P probably damaging Het
Gvin2 T C 7: 105,551,262 (GRCm39) K597E possibly damaging Het
Herc6 A G 6: 57,636,663 (GRCm39) N793S probably benign Het
Ikbke A T 1: 131,191,025 (GRCm39) S563T probably benign Het
Il1r2 T C 1: 40,144,478 (GRCm39) L55P probably damaging Het
Klhl8 C A 5: 104,012,111 (GRCm39) A575S probably benign Het
Lims1 T G 10: 58,254,265 (GRCm39) C340G probably damaging Het
Loxl3 G A 6: 83,026,292 (GRCm39) C460Y probably damaging Het
Mapk9 T A 11: 49,763,565 (GRCm39) L152* probably null Het
Mef2d T C 3: 88,066,463 (GRCm39) V144A possibly damaging Het
Mertk A G 2: 128,620,892 (GRCm39) D578G possibly damaging Het
Mettl1 C A 10: 126,881,250 (GRCm39) Q254K probably benign Het
Ndor1 A G 2: 25,138,241 (GRCm39) F484L probably damaging Het
Neurl1b C T 17: 26,660,055 (GRCm39) T425I possibly damaging Het
Nomo1 G A 7: 45,730,828 (GRCm39) V1104M possibly damaging Het
Or13a19 G T 7: 139,903,121 (GRCm39) G170C probably damaging Het
Or13p8 T A 4: 118,583,850 (GRCm39) Y135* probably null Het
Or4c10b T C 2: 89,711,515 (GRCm39) V115A probably benign Het
Or5b95 A G 19: 12,657,600 (GRCm39) M43V probably benign Het
Or5p57 A G 7: 107,665,246 (GRCm39) V223A probably benign Het
Or8g20 T A 9: 39,396,247 (GRCm39) M98L probably benign Het
Or9i2 A G 19: 13,815,796 (GRCm39) V247A probably damaging Het
Parp4 A G 14: 56,873,274 (GRCm39) K1173E possibly damaging Het
Phkb T A 8: 86,697,623 (GRCm39) N477K probably damaging Het
Plekha7 T G 7: 115,739,926 (GRCm39) I812L possibly damaging Het
Plxnb1 A G 9: 108,941,651 (GRCm39) T1711A probably damaging Het
Polg A G 7: 79,109,857 (GRCm39) V382A probably benign Het
Pomt2 T A 12: 87,194,451 (GRCm39) probably benign Het
Prdm1 T C 10: 44,316,123 (GRCm39) H671R probably damaging Het
Prkca G A 11: 107,870,244 (GRCm39) R15C possibly damaging Het
Prkch T A 12: 73,746,968 (GRCm39) N282K probably damaging Het
Ptpn6 T C 6: 124,702,249 (GRCm39) R385G probably benign Het
Rad21 A T 15: 51,841,455 (GRCm39) M87K probably damaging Het
Safb2 ACTTCTTCT ACTTCT 17: 56,878,292 (GRCm39) probably benign Het
Scn1a A T 2: 66,103,689 (GRCm39) V1857E probably damaging Het
Shprh A G 10: 11,036,320 (GRCm39) T386A probably benign Het
Slco1b2 T C 6: 141,598,229 (GRCm39) L94P probably damaging Het
Snx29 A G 16: 11,236,728 (GRCm39) N90D probably benign Het
Stt3a A T 9: 36,662,592 (GRCm39) H222Q probably damaging Het
Tbc1d5 T C 17: 51,089,363 (GRCm39) T584A probably benign Het
Tktl2 T C 8: 66,964,664 (GRCm39) V74A probably damaging Het
Tpp2 A G 1: 44,031,553 (GRCm39) N1124D probably null Het
Trpv1 A T 11: 73,130,481 (GRCm39) T196S probably benign Het
Ulk4 T C 9: 120,974,128 (GRCm39) E968G probably benign Het
Zbtb8a G T 4: 129,254,221 (GRCm39) T91K probably damaging Het
Zfp317 T A 9: 19,559,163 (GRCm39) V459E probably damaging Het
Zfp790 A G 7: 29,529,387 (GRCm39) T691A probably benign Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100,291,395 (GRCm39) missense probably benign 0.00
IGL00676:Naip2 APN 13 100,289,140 (GRCm39) missense probably damaging 1.00
IGL00870:Naip2 APN 13 100,288,568 (GRCm39) splice site probably benign
IGL00908:Naip2 APN 13 100,297,157 (GRCm39) missense probably benign 0.01
IGL00916:Naip2 APN 13 100,297,939 (GRCm39) missense probably damaging 0.97
IGL00949:Naip2 APN 13 100,298,099 (GRCm39) missense probably damaging 1.00
IGL01010:Naip2 APN 13 100,291,446 (GRCm39) missense probably damaging 0.99
IGL01642:Naip2 APN 13 100,297,445 (GRCm39) missense probably damaging 0.97
IGL01884:Naip2 APN 13 100,325,329 (GRCm39) splice site probably benign
IGL01917:Naip2 APN 13 100,298,591 (GRCm39) missense probably benign 0.00
IGL02015:Naip2 APN 13 100,298,115 (GRCm39) missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100,297,744 (GRCm39) missense probably damaging 1.00
IGL02328:Naip2 APN 13 100,297,877 (GRCm39) missense probably damaging 1.00
IGL02735:Naip2 APN 13 100,296,722 (GRCm39) missense probably damaging 0.99
IGL02738:Naip2 APN 13 100,325,685 (GRCm39) missense probably benign 0.01
IGL02887:Naip2 APN 13 100,298,020 (GRCm39) missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100,320,297 (GRCm39) missense probably benign
IGL02894:Naip2 APN 13 100,297,505 (GRCm39) missense probably damaging 1.00
IGL02974:Naip2 APN 13 100,298,186 (GRCm39) missense probably damaging 1.00
IGL03024:Naip2 APN 13 100,325,862 (GRCm39) missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100,298,795 (GRCm39) missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100,298,128 (GRCm39) missense probably damaging 0.99
R0131:Naip2 UTSW 13 100,320,296 (GRCm39) missense probably benign 0.01
R0131:Naip2 UTSW 13 100,320,296 (GRCm39) missense probably benign 0.01
R0132:Naip2 UTSW 13 100,320,296 (GRCm39) missense probably benign 0.01
R0310:Naip2 UTSW 13 100,285,350 (GRCm39) missense probably damaging 1.00
R0367:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0368:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0422:Naip2 UTSW 13 100,297,621 (GRCm39) missense probably benign 0.10
R0441:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0445:Naip2 UTSW 13 100,298,395 (GRCm39) missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0464:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0466:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0467:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0486:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0533:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R0853:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R0853:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R0855:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R0855:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R0904:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R0904:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R0906:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R0906:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R0908:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R0908:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R0959:Naip2 UTSW 13 100,291,419 (GRCm39) missense probably benign 0.03
R0959:Naip2 UTSW 13 100,291,386 (GRCm39) missense probably benign 0.01
R0962:Naip2 UTSW 13 100,315,893 (GRCm39) missense probably damaging 1.00
R1024:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1024:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1186:Naip2 UTSW 13 100,298,545 (GRCm39) frame shift probably null
R1186:Naip2 UTSW 13 100,298,489 (GRCm39) missense possibly damaging 0.63
R1217:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1217:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1340:Naip2 UTSW 13 100,325,630 (GRCm39) missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1342:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1404:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1423:Naip2 UTSW 13 100,291,355 (GRCm39) intron probably benign
R1423:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1423:Naip2 UTSW 13 100,291,386 (GRCm39) missense probably benign 0.01
R1423:Naip2 UTSW 13 100,291,380 (GRCm39) missense possibly damaging 0.59
R1426:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1426:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1472:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1575:Naip2 UTSW 13 100,291,537 (GRCm39) intron probably benign
R1575:Naip2 UTSW 13 100,291,529 (GRCm39) missense probably benign 0.00
R1576:Naip2 UTSW 13 100,291,529 (GRCm39) missense probably benign 0.00
R1576:Naip2 UTSW 13 100,291,537 (GRCm39) intron probably benign
R1599:Naip2 UTSW 13 100,298,489 (GRCm39) missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100,298,489 (GRCm39) missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100,298,489 (GRCm39) missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100,298,489 (GRCm39) missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100,298,489 (GRCm39) missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100,319,437 (GRCm39) missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1681:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1891:Naip2 UTSW 13 100,291,395 (GRCm39) missense probably benign 0.00
R1913:Naip2 UTSW 13 100,288,665 (GRCm39) critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100,298,368 (GRCm39) missense probably benign 0.00
R1937:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign
R1993:Naip2 UTSW 13 100,298,515 (GRCm39) missense probably benign 0.03
R2001:Naip2 UTSW 13 100,281,096 (GRCm39) missense probably damaging 1.00
R2055:Naip2 UTSW 13 100,315,880 (GRCm39) missense probably benign 0.07
R2198:Naip2 UTSW 13 100,289,100 (GRCm39) missense probably damaging 1.00
R2906:Naip2 UTSW 13 100,298,504 (GRCm39) missense probably damaging 1.00
R2931:Naip2 UTSW 13 100,291,529 (GRCm39) missense probably benign 0.00
R3014:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R3016:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R3037:Naip2 UTSW 13 100,291,457 (GRCm39) missense probably benign 0.08
R3414:Naip2 UTSW 13 100,325,771 (GRCm39) nonsense probably null
R3437:Naip2 UTSW 13 100,291,419 (GRCm39) missense probably benign 0.03
R3713:Naip2 UTSW 13 100,298,410 (GRCm39) missense probably damaging 1.00
R3806:Naip2 UTSW 13 100,289,142 (GRCm39) missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100,315,940 (GRCm39) missense probably damaging 1.00
R3847:Naip2 UTSW 13 100,315,941 (GRCm39) missense probably damaging 1.00
R3848:Naip2 UTSW 13 100,315,940 (GRCm39) missense probably damaging 1.00
R3848:Naip2 UTSW 13 100,315,941 (GRCm39) missense probably damaging 1.00
R3849:Naip2 UTSW 13 100,315,940 (GRCm39) missense probably damaging 1.00
R3849:Naip2 UTSW 13 100,315,941 (GRCm39) missense probably damaging 1.00
R3850:Naip2 UTSW 13 100,315,940 (GRCm39) missense probably damaging 1.00
R3850:Naip2 UTSW 13 100,315,941 (GRCm39) missense probably damaging 1.00
R3891:Naip2 UTSW 13 100,297,606 (GRCm39) missense probably damaging 0.99
R4419:Naip2 UTSW 13 100,297,133 (GRCm39) missense probably benign 0.03
R4456:Naip2 UTSW 13 100,291,419 (GRCm39) missense probably benign 0.03
R4458:Naip2 UTSW 13 100,291,419 (GRCm39) missense probably benign 0.03
R4689:Naip2 UTSW 13 100,285,320 (GRCm39) missense probably damaging 1.00
R4797:Naip2 UTSW 13 100,298,243 (GRCm39) missense probably damaging 1.00
R4852:Naip2 UTSW 13 100,298,044 (GRCm39) missense probably benign
R4922:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R5135:Naip2 UTSW 13 100,315,948 (GRCm39) missense probably damaging 0.98
R5185:Naip2 UTSW 13 100,325,859 (GRCm39) missense probably damaging 1.00
R5265:Naip2 UTSW 13 100,289,068 (GRCm39) missense probably damaging 1.00
R5451:Naip2 UTSW 13 100,325,368 (GRCm39) missense probably benign 0.12
R5521:Naip2 UTSW 13 100,291,422 (GRCm39) missense probably damaging 1.00
R5737:Naip2 UTSW 13 100,298,362 (GRCm39) missense probably benign 0.38
R6244:Naip2 UTSW 13 100,288,645 (GRCm39) missense probably damaging 1.00
R6478:Naip2 UTSW 13 100,298,549 (GRCm39) missense probably benign
R6480:Naip2 UTSW 13 100,298,549 (GRCm39) missense probably benign
R6481:Naip2 UTSW 13 100,298,549 (GRCm39) missense probably benign
R6490:Naip2 UTSW 13 100,297,193 (GRCm39) missense probably benign
R6653:Naip2 UTSW 13 100,288,644 (GRCm39) missense probably benign 0.00
R6653:Naip2 UTSW 13 100,298,352 (GRCm39) missense probably benign
R6768:Naip2 UTSW 13 100,314,832 (GRCm39) nonsense probably null
R6791:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R6793:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R6890:Naip2 UTSW 13 100,298,549 (GRCm39) missense probably benign
R7036:Naip2 UTSW 13 100,291,529 (GRCm39) missense probably benign 0.00
R7213:Naip2 UTSW 13 100,323,991 (GRCm39) missense probably damaging 1.00
R7342:Naip2 UTSW 13 100,325,864 (GRCm39) missense probably benign 0.09
R7445:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R7572:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R7699:Naip2 UTSW 13 100,296,877 (GRCm39) missense probably benign 0.00
R7840:Naip2 UTSW 13 100,280,917 (GRCm39) missense probably benign 0.14
R7874:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R7874:Naip2 UTSW 13 100,291,459 (GRCm39) missense probably benign 0.00
R8038:Naip2 UTSW 13 100,298,570 (GRCm39) missense probably benign 0.00
R8065:Naip2 UTSW 13 100,325,730 (GRCm39) missense probably damaging 1.00
R8094:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R8166:Naip2 UTSW 13 100,298,515 (GRCm39) missense probably benign 0.03
R8378:Naip2 UTSW 13 100,298,290 (GRCm39) missense probably benign 0.01
R8669:Naip2 UTSW 13 100,325,477 (GRCm39) missense probably benign 0.05
R8691:Naip2 UTSW 13 100,297,676 (GRCm39) missense probably damaging 1.00
R8716:Naip2 UTSW 13 100,280,914 (GRCm39) missense probably benign
R8720:Naip2 UTSW 13 100,298,630 (GRCm39) missense probably benign 0.04
R8888:Naip2 UTSW 13 100,325,644 (GRCm39) missense probably benign 0.01
R8895:Naip2 UTSW 13 100,325,644 (GRCm39) missense probably benign 0.01
R9031:Naip2 UTSW 13 100,314,776 (GRCm39) missense possibly damaging 0.55
R9072:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R9072:Naip2 UTSW 13 100,291,459 (GRCm39) missense probably benign 0.00
R9074:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R9074:Naip2 UTSW 13 100,291,459 (GRCm39) missense probably benign 0.00
R9077:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
R9077:Naip2 UTSW 13 100,291,459 (GRCm39) missense probably benign 0.00
R9219:Naip2 UTSW 13 100,297,213 (GRCm39) missense probably benign 0.06
R9358:Naip2 UTSW 13 100,298,080 (GRCm39) missense probably damaging 1.00
R9371:Naip2 UTSW 13 100,298,354 (GRCm39) nonsense probably null
R9414:Naip2 UTSW 13 100,298,243 (GRCm39) missense probably damaging 1.00
R9415:Naip2 UTSW 13 100,298,243 (GRCm39) missense probably damaging 1.00
R9416:Naip2 UTSW 13 100,298,243 (GRCm39) missense probably damaging 1.00
R9708:Naip2 UTSW 13 100,298,087 (GRCm39) missense probably damaging 0.99
V5622:Naip2 UTSW 13 100,291,537 (GRCm39) intron probably benign
V5622:Naip2 UTSW 13 100,291,529 (GRCm39) missense probably benign 0.00
V5622:Naip2 UTSW 13 100,291,529 (GRCm39) missense probably benign 0.00
X0063:Naip2 UTSW 13 100,298,266 (GRCm39) missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100,291,468 (GRCm39) missense probably benign
Z1088:Naip2 UTSW 13 100,298,417 (GRCm39) missense probably benign
Z1176:Naip2 UTSW 13 100,298,417 (GRCm39) missense probably benign
Z1176:Naip2 UTSW 13 100,298,101 (GRCm39) missense probably benign 0.02
Z1177:Naip2 UTSW 13 100,298,417 (GRCm39) missense probably benign
Z1177:Naip2 UTSW 13 100,289,137 (GRCm39) missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100,299,373 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTTGTCTTTCCACTGCC -3'
(R):5'- CAGATGTTTCTCCAAGTGAAGC -3'

Sequencing Primer
(F):5'- CCACACACATGACAGAGTTGAGATTG -3'
(R):5'- TGTTTCTCCAAGTGAAGCCCAGG -3'
Posted On 2022-02-07