Incidental Mutation 'R9176:Naip2'
ID 696703
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene Name NLR family, apoptosis inhibitory protein 2
Synonyms Birc1b, Naip2, Naip-rs6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100144063-100202092 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100162199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 443 (E443G)
Ref Sequence ENSEMBL: ENSMUSP00000070827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
AlphaFold Q9QUK4
Predicted Effect probably damaging
Transcript: ENSMUST00000067975
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: E443G

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117913
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: E443G

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167986
AA Change: E443G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: E443G

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,194 D119G probably damaging Het
1700123K08Rik T C 5: 138,562,893 D169G probably damaging Het
4932438A13Rik T A 3: 36,956,703 V1750E possibly damaging Het
Abcd2 T G 15: 91,191,420 R63S probably benign Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Avil T C 10: 127,016,379 Y678H probably damaging Het
Cd300ld2 C A 11: 115,013,946 E32* probably null Het
Chuk A T 19: 44,088,003 L423Q probably damaging Het
Cisd3 A G 11: 97,688,301 T90A probably damaging Het
Cmpk2 T A 12: 26,474,028 S275T probably benign Het
Cntnap5c T A 17: 58,313,735 N936K probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col4a4 G T 1: 82,485,628 P1047Q unknown Het
Col6a4 A G 9: 106,061,556 L1321P probably damaging Het
Crat A G 2: 30,407,880 F211L probably damaging Het
Csmd3 T C 15: 48,001,541 Q27R Het
Dapk1 T C 13: 60,718,448 V205A probably damaging Het
Ddx20 T C 3: 105,678,842 N729S probably benign Het
Derl2 A G 11: 71,013,550 V139A possibly damaging Het
Dscam C T 16: 96,685,353 D1041N probably benign Het
E2f4 TAGCAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG TAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG 8: 105,301,368 probably benign Het
Fam160b2 T C 14: 70,589,100 K183E probably benign Het
Fbxo2 A T 4: 148,165,690 R226W probably damaging Het
Gm4070 T C 7: 105,902,055 K597E possibly damaging Het
Gpr19 A G 6: 134,869,755 S322P probably damaging Het
Herc6 A G 6: 57,659,678 N793S probably benign Het
Ikbke A T 1: 131,263,288 S563T probably benign Het
Il1r2 T C 1: 40,105,318 L55P probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Lims1 T G 10: 58,418,443 C340G probably damaging Het
Loxl3 G A 6: 83,049,311 C460Y probably damaging Het
Mapk9 T A 11: 49,872,738 L152* probably null Het
Mef2d T C 3: 88,159,156 V144A possibly damaging Het
Mertk A G 2: 128,778,972 D578G possibly damaging Het
Mettl1 C A 10: 127,045,381 Q254K probably benign Het
Ndor1 A G 2: 25,248,229 F484L probably damaging Het
Neurl1b C T 17: 26,441,081 T425I possibly damaging Het
Nomo1 G A 7: 46,081,404 V1104M possibly damaging Het
Olfr1257 T C 2: 89,881,171 V115A probably benign Het
Olfr1340 T A 4: 118,726,653 Y135* probably null Het
Olfr1443 A G 19: 12,680,236 M43V probably benign Het
Olfr1501 A G 19: 13,838,432 V247A probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr480 A G 7: 108,066,039 V223A probably benign Het
Olfr525 G T 7: 140,323,208 G170C probably damaging Het
Parp4 A G 14: 56,635,817 K1173E possibly damaging Het
Phkb T A 8: 85,970,994 N477K probably damaging Het
Plekha7 T G 7: 116,140,691 I812L possibly damaging Het
Plxnb1 A G 9: 109,112,583 T1711A probably damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Pomt2 T A 12: 87,147,677 probably benign Het
Prdm1 T C 10: 44,440,127 H671R probably damaging Het
Prkca G A 11: 107,979,418 R15C possibly damaging Het
Prkch T A 12: 73,700,194 N282K probably damaging Het
Ptpn6 T C 6: 124,725,286 R385G probably benign Het
Rad21 A T 15: 51,978,059 M87K probably damaging Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Scn1a A T 2: 66,273,345 V1857E probably damaging Het
Shprh A G 10: 11,160,576 T386A probably benign Het
Slco1b2 T C 6: 141,652,503 L94P probably damaging Het
Snx29 A G 16: 11,418,864 N90D probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tbc1d5 T C 17: 50,782,335 T584A probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tpp2 A G 1: 43,992,393 N1124D probably null Het
Trpv1 A T 11: 73,239,655 T196S probably benign Het
Ulk4 T C 9: 121,145,062 E968G probably benign Het
Zbtb8a G T 4: 129,360,428 T91K probably damaging Het
Zfp317 T A 9: 19,647,867 V459E probably damaging Het
Zfp790 A G 7: 29,829,962 T691A probably benign Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
R7699:Naip2 UTSW 13 100160369 missense probably benign 0.00
R7840:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7874:Naip2 UTSW 13 100154951 missense probably benign 0.00
R7874:Naip2 UTSW 13 100154960 missense probably benign
R8038:Naip2 UTSW 13 100162062 missense probably benign 0.00
R8065:Naip2 UTSW 13 100189222 missense probably damaging 1.00
R8094:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8166:Naip2 UTSW 13 100162007 missense probably benign 0.03
R8378:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8669:Naip2 UTSW 13 100188969 missense probably benign 0.05
R8691:Naip2 UTSW 13 100161168 missense probably damaging 1.00
R8716:Naip2 UTSW 13 100144406 missense probably benign
R8720:Naip2 UTSW 13 100162122 missense probably benign 0.04
R8888:Naip2 UTSW 13 100189136 missense probably benign 0.01
R8895:Naip2 UTSW 13 100189136 missense probably benign 0.01
R9031:Naip2 UTSW 13 100178268 missense possibly damaging 0.55
R9072:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9072:Naip2 UTSW 13 100154960 missense probably benign
R9074:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9074:Naip2 UTSW 13 100154960 missense probably benign
R9077:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9077:Naip2 UTSW 13 100154960 missense probably benign
R9219:Naip2 UTSW 13 100160705 missense probably benign 0.06
R9358:Naip2 UTSW 13 100161572 missense probably damaging 1.00
R9371:Naip2 UTSW 13 100161846 nonsense probably null
R9414:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9415:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9416:Naip2 UTSW 13 100161735 missense probably damaging 1.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Z1176:Naip2 UTSW 13 100161593 missense probably benign 0.02
Z1176:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100152629 missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100162865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTTGTCTTTCCACTGCC -3'
(R):5'- CAGATGTTTCTCCAAGTGAAGC -3'

Sequencing Primer
(F):5'- CCACACACATGACAGAGTTGAGATTG -3'
(R):5'- TGTTTCTCCAAGTGAAGCCCAGG -3'
Posted On 2022-02-07