Incidental Mutation 'R9176:Parp4'
ID 696705
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Name poly (ADP-ribose) polymerase family, member 4
Synonyms p193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R9176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 56575619-56659794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56635817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1173 (K1173E)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
AlphaFold E9PYK3
Predicted Effect possibly damaging
Transcript: ENSMUST00000161553
AA Change: K1173E

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: K1173E

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik T C 5: 146,184,194 D119G probably damaging Het
1700123K08Rik T C 5: 138,562,893 D169G probably damaging Het
4932438A13Rik T A 3: 36,956,703 V1750E possibly damaging Het
Abcd2 T G 15: 91,191,420 R63S probably benign Het
Ankrd55 T C 13: 112,323,076 V68A possibly damaging Het
Avil T C 10: 127,016,379 Y678H probably damaging Het
Cd300ld2 C A 11: 115,013,946 E32* probably null Het
Chuk A T 19: 44,088,003 L423Q probably damaging Het
Cisd3 A G 11: 97,688,301 T90A probably damaging Het
Cmpk2 T A 12: 26,474,028 S275T probably benign Het
Cntnap5c T A 17: 58,313,735 N936K probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col4a4 G T 1: 82,485,628 P1047Q unknown Het
Col6a4 A G 9: 106,061,556 L1321P probably damaging Het
Crat A G 2: 30,407,880 F211L probably damaging Het
Csmd3 T C 15: 48,001,541 Q27R Het
Dapk1 T C 13: 60,718,448 V205A probably damaging Het
Ddx20 T C 3: 105,678,842 N729S probably benign Het
Derl2 A G 11: 71,013,550 V139A possibly damaging Het
Dscam C T 16: 96,685,353 D1041N probably benign Het
E2f4 TAGCAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG TAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAG 8: 105,301,368 probably benign Het
Fam160b2 T C 14: 70,589,100 K183E probably benign Het
Fbxo2 A T 4: 148,165,690 R226W probably damaging Het
Gm4070 T C 7: 105,902,055 K597E possibly damaging Het
Gpr19 A G 6: 134,869,755 S322P probably damaging Het
Herc6 A G 6: 57,659,678 N793S probably benign Het
Ikbke A T 1: 131,263,288 S563T probably benign Het
Il1r2 T C 1: 40,105,318 L55P probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Lims1 T G 10: 58,418,443 C340G probably damaging Het
Loxl3 G A 6: 83,049,311 C460Y probably damaging Het
Mapk9 T A 11: 49,872,738 L152* probably null Het
Mef2d T C 3: 88,159,156 V144A possibly damaging Het
Mertk A G 2: 128,778,972 D578G possibly damaging Het
Mettl1 C A 10: 127,045,381 Q254K probably benign Het
Naip2 T C 13: 100,162,199 E443G probably damaging Het
Ndor1 A G 2: 25,248,229 F484L probably damaging Het
Neurl1b C T 17: 26,441,081 T425I possibly damaging Het
Nomo1 G A 7: 46,081,404 V1104M possibly damaging Het
Olfr1257 T C 2: 89,881,171 V115A probably benign Het
Olfr1340 T A 4: 118,726,653 Y135* probably null Het
Olfr1443 A G 19: 12,680,236 M43V probably benign Het
Olfr1501 A G 19: 13,838,432 V247A probably damaging Het
Olfr44 T A 9: 39,484,951 M98L probably benign Het
Olfr480 A G 7: 108,066,039 V223A probably benign Het
Olfr525 G T 7: 140,323,208 G170C probably damaging Het
Phkb T A 8: 85,970,994 N477K probably damaging Het
Plekha7 T G 7: 116,140,691 I812L possibly damaging Het
Plxnb1 A G 9: 109,112,583 T1711A probably damaging Het
Polg A G 7: 79,460,109 V382A probably benign Het
Pomt2 T A 12: 87,147,677 probably benign Het
Prdm1 T C 10: 44,440,127 H671R probably damaging Het
Prkca G A 11: 107,979,418 R15C possibly damaging Het
Prkch T A 12: 73,700,194 N282K probably damaging Het
Ptpn6 T C 6: 124,725,286 R385G probably benign Het
Rad21 A T 15: 51,978,059 M87K probably damaging Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Scn1a A T 2: 66,273,345 V1857E probably damaging Het
Shprh A G 10: 11,160,576 T386A probably benign Het
Slco1b2 T C 6: 141,652,503 L94P probably damaging Het
Snx29 A G 16: 11,418,864 N90D probably benign Het
Stt3a A T 9: 36,751,296 H222Q probably damaging Het
Tbc1d5 T C 17: 50,782,335 T584A probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tpp2 A G 1: 43,992,393 N1124D probably null Het
Trpv1 A T 11: 73,239,655 T196S probably benign Het
Ulk4 T C 9: 121,145,062 E968G probably benign Het
Zbtb8a G T 4: 129,360,428 T91K probably damaging Het
Zfp317 T A 9: 19,647,867 V459E probably damaging Het
Zfp790 A G 7: 29,829,962 T691A probably benign Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
poisonous UTSW 14 56635748 missense possibly damaging 0.65
R0515_Parp4_195 UTSW 14 56613667 missense probably damaging 1.00
toxic UTSW 14 56629158 missense probably benign 0.28
venomous UTSW 14 56589898 missense possibly damaging 0.92
virulent UTSW 14 56587778 missense probably damaging 0.97
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R6995:Parp4 UTSW 14 56613739 missense probably damaging 0.97
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56659348 missense unknown
R7960:Parp4 UTSW 14 56595251 splice site probably null
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
R8344:Parp4 UTSW 14 56648729 missense unknown
R8416:Parp4 UTSW 14 56587814 critical splice donor site probably null
R8726:Parp4 UTSW 14 56629099 missense probably benign 0.04
R8752:Parp4 UTSW 14 56648616 missense unknown
R8804:Parp4 UTSW 14 56616443 nonsense probably null
R9046:Parp4 UTSW 14 56627470 missense probably damaging 0.98
R9303:Parp4 UTSW 14 56595333 frame shift probably null
R9303:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9305:Parp4 UTSW 14 56595333 frame shift probably null
R9305:Parp4 UTSW 14 56614767 critical splice donor site probably null
R9360:Parp4 UTSW 14 56641318 critical splice donor site probably null
R9430:Parp4 UTSW 14 56629216 missense probably damaging 1.00
R9491:Parp4 UTSW 14 56595371 missense probably damaging 0.99
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGGAGTGGTTCACA -3'
(R):5'- AGGCCAGCCTTGTCTACACT -3'

Sequencing Primer
(F):5'- AGCCTGGTCTACATAGCAAGTTCTG -3'
(R):5'- GCCTTGTCTACACTATCTCAAAAAGG -3'
Posted On 2022-02-07