Incidental Mutation 'R9177:1110002E22Rik'
ID 696733
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R9177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 138069916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1622 (V1622D)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: V1622D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V1622D

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb C T 7: 131,432,034 T260I probably damaging Het
Acap2 A T 16: 31,136,574 V161E probably damaging Het
Alk T C 17: 71,874,195 T1367A probably damaging Het
Atg2a A C 19: 6,241,875 H27P probably damaging Het
Atp2c1 C T 9: 105,459,659 probably null Het
C1s1 T G 6: 124,531,403 K542N probably damaging Het
Camk1d A G 2: 5,299,090 S351P probably benign Het
Carf C A 1: 60,109,399 Q85K possibly damaging Het
Caskin2 T C 11: 115,807,857 N43S probably damaging Het
Cd40 T C 2: 165,063,545 C161R probably damaging Het
Cdh19 A G 1: 110,949,381 F76S probably damaging Het
Cdkl1 T C 12: 69,747,326 N346D probably benign Het
Cdon A G 9: 35,469,934 D540G probably benign Het
Cep164 T A 9: 45,779,762 E379V probably damaging Het
Clock T C 5: 76,229,409 N681S probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col6a5 T G 9: 105,930,953 K965N unknown Het
Dctn4 T A 18: 60,526,232 M1K probably null Het
Dhx30 T C 9: 110,086,682 D741G probably damaging Het
Dhx37 A G 5: 125,430,894 V104A probably benign Het
Dnah12 A G 14: 26,849,298 K2788R possibly damaging Het
Egfr T A 11: 16,905,410 D898E probably damaging Het
Eif2ak4 G C 2: 118,441,220 probably null Het
Eif6 A G 2: 155,823,932 L101P probably damaging Het
Etaa1 A T 11: 17,946,419 V566E probably damaging Het
Fam126b T C 1: 58,552,202 D94G probably damaging Het
Far2 C T 6: 148,158,920 T257I probably benign Het
Fuca2 G A 10: 13,514,819 W453* probably null Het
Galntl6 A T 8: 57,857,556 Y370* probably null Het
Gcn1l1 T C 5: 115,581,808 V374A probably benign Het
Gm11238 T C 4: 73,657,136 S351P probably damaging Het
Gm884 T A 11: 103,617,437 H1235L unknown Het
Hfe2 T C 3: 96,528,565 F380L probably benign Het
Ifi202b A T 1: 173,977,383 M1K probably null Het
Lama4 A G 10: 39,074,692 Y997C probably damaging Het
Lepr T A 4: 101,745,601 C195* probably null Het
Lrrc73 T C 17: 46,254,609 S89P probably benign Het
Macf1 T C 4: 123,473,789 E2393G probably damaging Het
Mdga2 T A 12: 66,470,707 T118S possibly damaging Het
Mtf2 A G 5: 108,087,083 K124R probably benign Het
Muc5b T C 7: 141,845,338 Y339H unknown Het
Nes G A 3: 87,979,705 G1757E probably damaging Het
Nfatc4 A T 14: 55,827,228 I391F probably damaging Het
Nup93 A T 8: 94,227,743 I23F probably benign Het
Olfr1197 A C 2: 88,728,830 Y256* probably null Het
Olfr1499 A T 19: 13,815,024 C189S probably damaging Het
Olfr183 T G 16: 58,999,720 F12V probably damaging Het
Olfr220 A C 1: 174,449,357 T245P probably damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Pak7 A C 2: 136,101,206 M338R probably benign Het
Papola A G 12: 105,799,773 E44G probably benign Het
Pcdh15 A T 10: 74,643,623 E522V probably benign Het
Peli2 A G 14: 48,281,470 E225G probably benign Het
Pla2g1b T G 5: 115,474,536 I117S probably damaging Het
Plxnd1 G T 6: 115,966,508 Q1246K probably benign Het
Pole A G 5: 110,332,422 E1953G probably benign Het
Pus7l T C 15: 94,533,564 I395V probably benign Het
Shisa7 T G 7: 4,834,334 D244A probably damaging Het
Slco3a1 T C 7: 74,303,198 T538A probably benign Het
Syk T A 13: 52,612,444 N188K probably benign Het
Tcf20 A G 15: 82,856,504 S249P probably benign Het
Tmem25 T C 9: 44,798,232 T91A possibly damaging Het
Trank1 T C 9: 111,392,511 V2772A probably benign Het
Ttn A T 2: 76,766,103 Y20155* probably null Het
Uchl4 C T 9: 64,235,704 H156Y probably benign Het
Ulbp1 A T 10: 7,446,392 L295Q unknown Het
Vwf G A 6: 125,604,291 A631T Het
Zfp810 C T 9: 22,278,640 C324Y probably damaging Het
Zswim8 T C 14: 20,711,840 L227P probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCGAGAAACAGTCGTTG -3'
(R):5'- CACTGTGGGCAGAAATCCAG -3'

Sequencing Primer
(F):5'- TGTCTACCACCAGCAGGCATTG -3'
(R):5'- TCCAGGATAGATCATGTAGGTGG -3'
Posted On 2022-02-07