Incidental Mutation 'R9177:Plxnd1'
ID 696744
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115966508 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1246 (Q1246K)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: Q1246K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: Q1246K

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,069,916 V1622D probably damaging Het
Acadsb C T 7: 131,432,034 T260I probably damaging Het
Acap2 A T 16: 31,136,574 V161E probably damaging Het
Alk T C 17: 71,874,195 T1367A probably damaging Het
Atg2a A C 19: 6,241,875 H27P probably damaging Het
Atp2c1 C T 9: 105,459,659 probably null Het
C1s1 T G 6: 124,531,403 K542N probably damaging Het
Camk1d A G 2: 5,299,090 S351P probably benign Het
Carf C A 1: 60,109,399 Q85K possibly damaging Het
Caskin2 T C 11: 115,807,857 N43S probably damaging Het
Cd40 T C 2: 165,063,545 C161R probably damaging Het
Cdh19 A G 1: 110,949,381 F76S probably damaging Het
Cdkl1 T C 12: 69,747,326 N346D probably benign Het
Cdon A G 9: 35,469,934 D540G probably benign Het
Cep164 T A 9: 45,779,762 E379V probably damaging Het
Clock T C 5: 76,229,409 N681S probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col6a5 T G 9: 105,930,953 K965N unknown Het
Dctn4 T A 18: 60,526,232 M1K probably null Het
Dhx30 T C 9: 110,086,682 D741G probably damaging Het
Dhx37 A G 5: 125,430,894 V104A probably benign Het
Dnah12 A G 14: 26,849,298 K2788R possibly damaging Het
Egfr T A 11: 16,905,410 D898E probably damaging Het
Eif2ak4 G C 2: 118,441,220 probably null Het
Eif6 A G 2: 155,823,932 L101P probably damaging Het
Etaa1 A T 11: 17,946,419 V566E probably damaging Het
Fam126b T C 1: 58,552,202 D94G probably damaging Het
Far2 C T 6: 148,158,920 T257I probably benign Het
Fuca2 G A 10: 13,514,819 W453* probably null Het
Galntl6 A T 8: 57,857,556 Y370* probably null Het
Gcn1l1 T C 5: 115,581,808 V374A probably benign Het
Gm11238 T C 4: 73,657,136 S351P probably damaging Het
Gm884 T A 11: 103,617,437 H1235L unknown Het
Hfe2 T C 3: 96,528,565 F380L probably benign Het
Ifi202b A T 1: 173,977,383 M1K probably null Het
Lama4 A G 10: 39,074,692 Y997C probably damaging Het
Lepr T A 4: 101,745,601 C195* probably null Het
Lrrc73 T C 17: 46,254,609 S89P probably benign Het
Macf1 T C 4: 123,473,789 E2393G probably damaging Het
Mdga2 T A 12: 66,470,707 T118S possibly damaging Het
Mtf2 A G 5: 108,087,083 K124R probably benign Het
Muc5b T C 7: 141,845,338 Y339H unknown Het
Nes G A 3: 87,979,705 G1757E probably damaging Het
Nfatc4 A T 14: 55,827,228 I391F probably damaging Het
Nup93 A T 8: 94,227,743 I23F probably benign Het
Olfr1197 A C 2: 88,728,830 Y256* probably null Het
Olfr1499 A T 19: 13,815,024 C189S probably damaging Het
Olfr183 T G 16: 58,999,720 F12V probably damaging Het
Olfr220 A C 1: 174,449,357 T245P probably damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Pak7 A C 2: 136,101,206 M338R probably benign Het
Papola A G 12: 105,799,773 E44G probably benign Het
Pcdh15 A T 10: 74,643,623 E522V probably benign Het
Peli2 A G 14: 48,281,470 E225G probably benign Het
Pla2g1b T G 5: 115,474,536 I117S probably damaging Het
Pole A G 5: 110,332,422 E1953G probably benign Het
Pus7l T C 15: 94,533,564 I395V probably benign Het
Shisa7 T G 7: 4,834,334 D244A probably damaging Het
Slco3a1 T C 7: 74,303,198 T538A probably benign Het
Syk T A 13: 52,612,444 N188K probably benign Het
Tcf20 A G 15: 82,856,504 S249P probably benign Het
Tmem25 T C 9: 44,798,232 T91A possibly damaging Het
Trank1 T C 9: 111,392,511 V2772A probably benign Het
Ttn A T 2: 76,766,103 Y20155* probably null Het
Uchl4 C T 9: 64,235,704 H156Y probably benign Het
Ulbp1 A T 10: 7,446,392 L295Q unknown Het
Vwf G A 6: 125,604,291 A631T Het
Zfp810 C T 9: 22,278,640 C324Y probably damaging Het
Zswim8 T C 14: 20,711,840 L227P probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAATTGTGTAATAGCAGCTGGC -3'
(R):5'- TCGTCATCCATGTGAGCACC -3'

Sequencing Primer
(F):5'- GCTGGCACTAACCAATGACTTG -3'
(R):5'- ATCCATGTGAGCACCCGACTG -3'
Posted On 2022-02-07