Incidental Mutation 'R9177:Trank1'
ID 696763
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms A230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111311739-111395775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111392511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2772 (V2772A)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: V2772A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: V2772A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,069,916 V1622D probably damaging Het
Acadsb C T 7: 131,432,034 T260I probably damaging Het
Acap2 A T 16: 31,136,574 V161E probably damaging Het
Alk T C 17: 71,874,195 T1367A probably damaging Het
Atg2a A C 19: 6,241,875 H27P probably damaging Het
Atp2c1 C T 9: 105,459,659 probably null Het
C1s1 T G 6: 124,531,403 K542N probably damaging Het
Camk1d A G 2: 5,299,090 S351P probably benign Het
Carf C A 1: 60,109,399 Q85K possibly damaging Het
Caskin2 T C 11: 115,807,857 N43S probably damaging Het
Cd40 T C 2: 165,063,545 C161R probably damaging Het
Cdh19 A G 1: 110,949,381 F76S probably damaging Het
Cdkl1 T C 12: 69,747,326 N346D probably benign Het
Cdon A G 9: 35,469,934 D540G probably benign Het
Cep164 T A 9: 45,779,762 E379V probably damaging Het
Clock T C 5: 76,229,409 N681S probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col6a5 T G 9: 105,930,953 K965N unknown Het
Dctn4 T A 18: 60,526,232 M1K probably null Het
Dhx30 T C 9: 110,086,682 D741G probably damaging Het
Dhx37 A G 5: 125,430,894 V104A probably benign Het
Dnah12 A G 14: 26,849,298 K2788R possibly damaging Het
Egfr T A 11: 16,905,410 D898E probably damaging Het
Eif2ak4 G C 2: 118,441,220 probably null Het
Eif6 A G 2: 155,823,932 L101P probably damaging Het
Etaa1 A T 11: 17,946,419 V566E probably damaging Het
Fam126b T C 1: 58,552,202 D94G probably damaging Het
Far2 C T 6: 148,158,920 T257I probably benign Het
Fuca2 G A 10: 13,514,819 W453* probably null Het
Galntl6 A T 8: 57,857,556 Y370* probably null Het
Gcn1l1 T C 5: 115,581,808 V374A probably benign Het
Gm11238 T C 4: 73,657,136 S351P probably damaging Het
Gm884 T A 11: 103,617,437 H1235L unknown Het
Hfe2 T C 3: 96,528,565 F380L probably benign Het
Ifi202b A T 1: 173,977,383 M1K probably null Het
Lama4 A G 10: 39,074,692 Y997C probably damaging Het
Lepr T A 4: 101,745,601 C195* probably null Het
Lrrc73 T C 17: 46,254,609 S89P probably benign Het
Macf1 T C 4: 123,473,789 E2393G probably damaging Het
Mdga2 T A 12: 66,470,707 T118S possibly damaging Het
Mtf2 A G 5: 108,087,083 K124R probably benign Het
Muc5b T C 7: 141,845,338 Y339H unknown Het
Nes G A 3: 87,979,705 G1757E probably damaging Het
Nfatc4 A T 14: 55,827,228 I391F probably damaging Het
Nup93 A T 8: 94,227,743 I23F probably benign Het
Olfr1197 A C 2: 88,728,830 Y256* probably null Het
Olfr1499 A T 19: 13,815,024 C189S probably damaging Het
Olfr183 T G 16: 58,999,720 F12V probably damaging Het
Olfr220 A C 1: 174,449,357 T245P probably damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Pak7 A C 2: 136,101,206 M338R probably benign Het
Papola A G 12: 105,799,773 E44G probably benign Het
Pcdh15 A T 10: 74,643,623 E522V probably benign Het
Peli2 A G 14: 48,281,470 E225G probably benign Het
Pla2g1b T G 5: 115,474,536 I117S probably damaging Het
Plxnd1 G T 6: 115,966,508 Q1246K probably benign Het
Pole A G 5: 110,332,422 E1953G probably benign Het
Pus7l T C 15: 94,533,564 I395V probably benign Het
Shisa7 T G 7: 4,834,334 D244A probably damaging Het
Slco3a1 T C 7: 74,303,198 T538A probably benign Het
Syk T A 13: 52,612,444 N188K probably benign Het
Tcf20 A G 15: 82,856,504 S249P probably benign Het
Tmem25 T C 9: 44,798,232 T91A possibly damaging Het
Ttn A T 2: 76,766,103 Y20155* probably null Het
Uchl4 C T 9: 64,235,704 H156Y probably benign Het
Ulbp1 A T 10: 7,446,392 L295Q unknown Het
Vwf G A 6: 125,604,291 A631T Het
Zfp810 C T 9: 22,278,640 C324Y probably damaging Het
Zswim8 T C 14: 20,711,840 L227P probably damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111390107 missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111347912 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
R7127:Trank1 UTSW 9 111365796 missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111345515 critical splice donor site probably null
R7236:Trank1 UTSW 9 111373074 missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111367512 missense probably damaging 1.00
R7292:Trank1 UTSW 9 111377870 missense probably benign 0.02
R7310:Trank1 UTSW 9 111367126 missense probably damaging 1.00
R7431:Trank1 UTSW 9 111362402 missense probably benign 0.12
R7448:Trank1 UTSW 9 111366349 missense probably benign 0.01
R7477:Trank1 UTSW 9 111364957 missense probably benign 0.00
R7514:Trank1 UTSW 9 111364756 missense probably damaging 1.00
R7595:Trank1 UTSW 9 111365991 missense probably damaging 1.00
R7637:Trank1 UTSW 9 111365296 missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111391685 missense probably benign
R7737:Trank1 UTSW 9 111366012 nonsense probably null
R7784:Trank1 UTSW 9 111364103 missense probably damaging 1.00
R7884:Trank1 UTSW 9 111392516 missense probably benign
R7912:Trank1 UTSW 9 111391528 missense probably benign 0.04
R7938:Trank1 UTSW 9 111365028 missense probably benign
R7979:Trank1 UTSW 9 111377899 missense probably benign 0.00
R8064:Trank1 UTSW 9 111352076 nonsense probably null
R8100:Trank1 UTSW 9 111392793 missense probably damaging 1.00
R8124:Trank1 UTSW 9 111378927 missense probably benign 0.31
R8198:Trank1 UTSW 9 111390812 missense probably benign 0.09
R8219:Trank1 UTSW 9 111364909 missense probably damaging 1.00
R8223:Trank1 UTSW 9 111365889 missense probably damaging 1.00
R8316:Trank1 UTSW 9 111349302 missense probably benign 0.38
R8347:Trank1 UTSW 9 111367249 missense probably damaging 1.00
R8436:Trank1 UTSW 9 111391382 missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111390275 missense probably benign 0.01
R8682:Trank1 UTSW 9 111365344 missense probably benign 0.01
R8768:Trank1 UTSW 9 111389276 missense probably benign 0.00
R8770:Trank1 UTSW 9 111390824 missense probably benign 0.00
R8829:Trank1 UTSW 9 111347523 missense probably benign
R8838:Trank1 UTSW 9 111364905 missense probably benign 0.03
R8855:Trank1 UTSW 9 111312221 missense unknown
R8929:Trank1 UTSW 9 111378935 missense possibly damaging 0.93
R9047:Trank1 UTSW 9 111362432 missense probably damaging 0.99
R9090:Trank1 UTSW 9 111345479 missense probably damaging 1.00
R9114:Trank1 UTSW 9 111333775 missense probably damaging 1.00
R9133:Trank1 UTSW 9 111391702 missense possibly damaging 0.93
R9178:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R9271:Trank1 UTSW 9 111345479 missense probably damaging 1.00
R9314:Trank1 UTSW 9 111365981 missense probably damaging 1.00
R9373:Trank1 UTSW 9 111365191 missense probably benign 0.25
R9380:Trank1 UTSW 9 111392670 missense probably benign 0.07
R9435:Trank1 UTSW 9 111364822 missense probably benign 0.04
R9501:Trank1 UTSW 9 111347875 missense probably benign 0.00
R9593:Trank1 UTSW 9 111362297 missense probably benign 0.30
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111311902 missense unknown
Z1177:Trank1 UTSW 9 111367377 missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111392870 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGAGGAGGTCAGACTGAACC -3'
(R):5'- TGGAAATCAGCACAGCCTC -3'

Sequencing Primer
(F):5'- ACCAGTTTGCTGACTCAGAG -3'
(R):5'- CTGTGGCTGTTCCCTCAAATG -3'
Posted On 2022-02-07