Incidental Mutation 'R9178:Setd1a'
ID 696822
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 068978-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9178 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127385590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 766 (P766S)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect possibly damaging
Transcript: ENSMUST00000047075
AA Change: P766S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: P766S

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000047157
AA Change: P766S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: P766S

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154987
AA Change: P223S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,880,992 (GRCm39) T146S unknown Het
Abca8b A T 11: 109,840,937 (GRCm39) F1079I probably benign Het
Adcy10 A T 1: 165,403,218 (GRCm39) Q1572L possibly damaging Het
Akna T C 4: 63,312,846 (GRCm39) T426A possibly damaging Het
Alkbh8 A G 9: 3,338,448 (GRCm39) probably benign Het
Apc2 G A 10: 80,150,235 (GRCm39) G1763E probably benign Het
Bmp1 G T 14: 70,727,613 (GRCm39) R657S possibly damaging Het
Calm1 G A 12: 100,171,979 (GRCm39) probably null Het
Ccdc150 C A 1: 54,311,644 (GRCm39) A210E probably damaging Het
Cdc42bpa T C 1: 179,958,401 (GRCm39) I275T Het
Cfap54 G T 10: 92,830,579 (GRCm39) Q1186K probably benign Het
Col6a6 A G 9: 105,659,169 (GRCm39) V592A probably benign Het
Colec11 A T 12: 28,644,854 (GRCm39) N213K possibly damaging Het
Dennd2b C T 7: 109,156,291 (GRCm39) G153D probably benign Het
Dennd5b G A 6: 148,934,844 (GRCm39) R676* probably null Het
Dnaaf5 T G 5: 139,138,652 (GRCm39) Y278D probably damaging Het
Dop1a T A 9: 86,371,796 (GRCm39) Y162* probably null Het
Dync1li2 A G 8: 105,150,255 (GRCm39) L369P possibly damaging Het
Ebf1 A G 11: 44,883,276 (GRCm39) T505A probably benign Het
Ebf1 A G 11: 44,895,548 (GRCm39) I584M probably benign Het
Eif1ad17 A G 12: 87,978,786 (GRCm39) R57G probably damaging Het
Frmpd1 T C 4: 45,285,367 (GRCm39) L1396P probably damaging Het
Gart A T 16: 91,430,904 (GRCm39) V386D possibly damaging Het
Gprin1 C T 13: 54,885,601 (GRCm39) R891H probably damaging Het
Gsap G A 5: 21,422,471 (GRCm39) V147I probably damaging Het
Gsc G T 12: 104,439,120 (GRCm39) Y85* probably null Het
Gtf2a1l A G 17: 88,976,152 (GRCm39) N5S Het
Hmcn2 T C 2: 31,281,521 (GRCm39) V1912A possibly damaging Het
Icos G T 1: 61,034,714 (GRCm39) S179I probably damaging Het
Ifi209 T C 1: 173,464,969 (GRCm39) L33P probably damaging Het
Igsf10 A G 3: 59,233,480 (GRCm39) I1751T possibly damaging Het
Il31ra T C 13: 112,677,780 (GRCm39) Y252C probably damaging Het
Ints6 A T 14: 62,947,036 (GRCm39) S310T probably damaging Het
Kcng1 A T 2: 168,111,105 (GRCm39) S20T possibly damaging Het
Klf15 T C 6: 90,444,091 (GRCm39) I222T probably damaging Het
Lmo7 A T 14: 102,044,906 (GRCm39) K53* probably null Het
Map10 C A 8: 126,397,649 (GRCm39) N347K probably damaging Het
Mrps11 C A 7: 78,440,444 (GRCm39) T111K probably damaging Het
Myom3 T G 4: 135,506,710 (GRCm39) D494E probably benign Het
Naalad2 T A 9: 18,242,152 (GRCm39) Y584F probably damaging Het
Ndufa9 A G 6: 126,826,050 (GRCm39) V9A probably benign Het
Nrcam G T 12: 44,615,329 (GRCm39) V640F possibly damaging Het
Or10x4 C T 1: 174,219,229 (GRCm39) T198I probably benign Het
Or2t48 C A 11: 58,420,473 (GRCm39) G113V probably damaging Het
Or52d1 T C 7: 103,755,720 (GRCm39) M78T probably benign Het
Or5ak23 G A 2: 85,244,848 (GRCm39) A125V probably damaging Het
Pcdhga8 T A 18: 37,860,892 (GRCm39) H649Q probably benign Het
Pdk1 C A 2: 71,730,402 (GRCm39) H413Q probably benign Het
Pfkm T A 15: 98,027,161 (GRCm39) H611Q probably damaging Het
Polr3g T C 13: 81,842,535 (GRCm39) Y160C unknown Het
Ppargc1b A T 18: 61,443,993 (GRCm39) M406K probably benign Het
Ptf1a C T 2: 19,450,536 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,295,264 (GRCm39) C251S possibly damaging Het
Rnf32 A G 5: 29,411,211 (GRCm39) T166A possibly damaging Het
Sav1 A T 12: 70,022,790 (GRCm39) V254E probably damaging Het
Sel1l T C 12: 91,797,526 (GRCm39) N234D probably benign Het
Skida1 T A 2: 18,050,489 (GRCm39) K801* probably null Het
Slc22a5 G A 11: 53,774,547 (GRCm39) T146I probably benign Het
Slc25a24 G T 3: 109,064,268 (GRCm39) A206S possibly damaging Het
Slc39a6 G A 18: 24,733,970 (GRCm39) R240W probably damaging Het
Ssc5d T A 7: 4,930,058 (GRCm39) D46E probably damaging Het
Tekt4 C T 17: 25,690,901 (GRCm39) A69V possibly damaging Het
Tmigd1 T A 11: 76,804,878 (GRCm39) F239Y probably benign Het
Tpp1 T A 7: 105,400,846 (GRCm39) R60S probably benign Het
Trank1 A T 9: 111,196,268 (GRCm39) I1431F probably damaging Het
Trav15-1-dv6-1 G T 14: 53,797,519 (GRCm39) W56L probably damaging Het
Ugt2b38 A G 5: 87,568,396 (GRCm39) S300P probably damaging Het
Urah T A 7: 140,417,587 (GRCm39) L119Q unknown Het
Uspl1 T A 5: 149,141,148 (GRCm39) F382L probably damaging Het
Vps9d1 T A 8: 123,975,574 (GRCm39) Q157L probably damaging Het
Wbp1l G A 19: 46,640,933 (GRCm39) V88I probably benign Het
Zfp444 T C 7: 6,191,157 (GRCm39) S113P probably damaging Het
Zfp580 T G 7: 5,056,152 (GRCm39) S171A possibly damaging Het
Zfp607a A G 7: 27,577,382 (GRCm39) I151V probably benign Het
Zfp827 T C 8: 79,818,564 (GRCm39) F614S probably damaging Het
Zic4 A T 9: 91,260,913 (GRCm39) Q56L possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CATGTCCTTCCAGATGCAGAC -3'
(R):5'- AAGGTCTCGCTGCATAATGC -3'

Sequencing Primer
(F):5'- TGCAGACCCAGATGTTAACACGG -3'
(R):5'- CTCTTCATCTCTTGGACAAGGGTAG -3'
Posted On 2022-02-07