Incidental Mutation 'R9178:Bmp1'
ID 696855
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 068978-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9178 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70727613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 657 (R657S)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect possibly damaging
Transcript: ENSMUST00000022693
AA Change: R657S

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: R657S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,880,992 (GRCm39) T146S unknown Het
Abca8b A T 11: 109,840,937 (GRCm39) F1079I probably benign Het
Adcy10 A T 1: 165,403,218 (GRCm39) Q1572L possibly damaging Het
Akna T C 4: 63,312,846 (GRCm39) T426A possibly damaging Het
Alkbh8 A G 9: 3,338,448 (GRCm39) probably benign Het
Apc2 G A 10: 80,150,235 (GRCm39) G1763E probably benign Het
Calm1 G A 12: 100,171,979 (GRCm39) probably null Het
Ccdc150 C A 1: 54,311,644 (GRCm39) A210E probably damaging Het
Cdc42bpa T C 1: 179,958,401 (GRCm39) I275T Het
Cfap54 G T 10: 92,830,579 (GRCm39) Q1186K probably benign Het
Col6a6 A G 9: 105,659,169 (GRCm39) V592A probably benign Het
Colec11 A T 12: 28,644,854 (GRCm39) N213K possibly damaging Het
Dennd2b C T 7: 109,156,291 (GRCm39) G153D probably benign Het
Dennd5b G A 6: 148,934,844 (GRCm39) R676* probably null Het
Dnaaf5 T G 5: 139,138,652 (GRCm39) Y278D probably damaging Het
Dop1a T A 9: 86,371,796 (GRCm39) Y162* probably null Het
Dync1li2 A G 8: 105,150,255 (GRCm39) L369P possibly damaging Het
Ebf1 A G 11: 44,883,276 (GRCm39) T505A probably benign Het
Ebf1 A G 11: 44,895,548 (GRCm39) I584M probably benign Het
Eif1ad17 A G 12: 87,978,786 (GRCm39) R57G probably damaging Het
Frmpd1 T C 4: 45,285,367 (GRCm39) L1396P probably damaging Het
Gart A T 16: 91,430,904 (GRCm39) V386D possibly damaging Het
Gprin1 C T 13: 54,885,601 (GRCm39) R891H probably damaging Het
Gsap G A 5: 21,422,471 (GRCm39) V147I probably damaging Het
Gsc G T 12: 104,439,120 (GRCm39) Y85* probably null Het
Gtf2a1l A G 17: 88,976,152 (GRCm39) N5S Het
Hmcn2 T C 2: 31,281,521 (GRCm39) V1912A possibly damaging Het
Icos G T 1: 61,034,714 (GRCm39) S179I probably damaging Het
Ifi209 T C 1: 173,464,969 (GRCm39) L33P probably damaging Het
Igsf10 A G 3: 59,233,480 (GRCm39) I1751T possibly damaging Het
Il31ra T C 13: 112,677,780 (GRCm39) Y252C probably damaging Het
Ints6 A T 14: 62,947,036 (GRCm39) S310T probably damaging Het
Kcng1 A T 2: 168,111,105 (GRCm39) S20T possibly damaging Het
Klf15 T C 6: 90,444,091 (GRCm39) I222T probably damaging Het
Lmo7 A T 14: 102,044,906 (GRCm39) K53* probably null Het
Map10 C A 8: 126,397,649 (GRCm39) N347K probably damaging Het
Mrps11 C A 7: 78,440,444 (GRCm39) T111K probably damaging Het
Myom3 T G 4: 135,506,710 (GRCm39) D494E probably benign Het
Naalad2 T A 9: 18,242,152 (GRCm39) Y584F probably damaging Het
Ndufa9 A G 6: 126,826,050 (GRCm39) V9A probably benign Het
Nrcam G T 12: 44,615,329 (GRCm39) V640F possibly damaging Het
Or10x4 C T 1: 174,219,229 (GRCm39) T198I probably benign Het
Or2t48 C A 11: 58,420,473 (GRCm39) G113V probably damaging Het
Or52d1 T C 7: 103,755,720 (GRCm39) M78T probably benign Het
Or5ak23 G A 2: 85,244,848 (GRCm39) A125V probably damaging Het
Pcdhga8 T A 18: 37,860,892 (GRCm39) H649Q probably benign Het
Pdk1 C A 2: 71,730,402 (GRCm39) H413Q probably benign Het
Pfkm T A 15: 98,027,161 (GRCm39) H611Q probably damaging Het
Polr3g T C 13: 81,842,535 (GRCm39) Y160C unknown Het
Ppargc1b A T 18: 61,443,993 (GRCm39) M406K probably benign Het
Ptf1a C T 2: 19,450,536 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,295,264 (GRCm39) C251S possibly damaging Het
Rnf32 A G 5: 29,411,211 (GRCm39) T166A possibly damaging Het
Sav1 A T 12: 70,022,790 (GRCm39) V254E probably damaging Het
Sel1l T C 12: 91,797,526 (GRCm39) N234D probably benign Het
Setd1a C T 7: 127,385,590 (GRCm39) P766S possibly damaging Het
Skida1 T A 2: 18,050,489 (GRCm39) K801* probably null Het
Slc22a5 G A 11: 53,774,547 (GRCm39) T146I probably benign Het
Slc25a24 G T 3: 109,064,268 (GRCm39) A206S possibly damaging Het
Slc39a6 G A 18: 24,733,970 (GRCm39) R240W probably damaging Het
Ssc5d T A 7: 4,930,058 (GRCm39) D46E probably damaging Het
Tekt4 C T 17: 25,690,901 (GRCm39) A69V possibly damaging Het
Tmigd1 T A 11: 76,804,878 (GRCm39) F239Y probably benign Het
Tpp1 T A 7: 105,400,846 (GRCm39) R60S probably benign Het
Trank1 A T 9: 111,196,268 (GRCm39) I1431F probably damaging Het
Trav15-1-dv6-1 G T 14: 53,797,519 (GRCm39) W56L probably damaging Het
Ugt2b38 A G 5: 87,568,396 (GRCm39) S300P probably damaging Het
Urah T A 7: 140,417,587 (GRCm39) L119Q unknown Het
Uspl1 T A 5: 149,141,148 (GRCm39) F382L probably damaging Het
Vps9d1 T A 8: 123,975,574 (GRCm39) Q157L probably damaging Het
Wbp1l G A 19: 46,640,933 (GRCm39) V88I probably benign Het
Zfp444 T C 7: 6,191,157 (GRCm39) S113P probably damaging Het
Zfp580 T G 7: 5,056,152 (GRCm39) S171A possibly damaging Het
Zfp607a A G 7: 27,577,382 (GRCm39) I151V probably benign Het
Zfp827 T C 8: 79,818,564 (GRCm39) F614S probably damaging Het
Zic4 A T 9: 91,260,913 (GRCm39) Q56L possibly damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGACTCCAGAGTTACCTG -3'
(R):5'- ACAGAAGCTCAGAGGGCTTG -3'

Sequencing Primer
(F):5'- TTACCTGAGAAGAAGTGGGCCTTG -3'
(R):5'- TCGCAAAGGAGGCTCTGCAG -3'
Posted On 2022-02-07