Incidental Mutation 'R9178:Gart'
ID 696858
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Name phosphoribosylglycinamide formyltransferase
Synonyms Gaps, Prgs
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9178 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 91621186-91646952 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91634016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 386 (V386D)
Ref Sequence ENSEMBL: ENSMUSP00000023684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000232289] [ENSMUST00000232367]
AlphaFold Q64737
Predicted Effect possibly damaging
Transcript: ENSMUST00000023684
AA Change: V386D

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: V386D

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120450
AA Change: V386D

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: V386D

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231380
AA Change: V386D

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000232289
AA Change: V386D

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000232367
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,973,708 T146S unknown Het
Abca8b A T 11: 109,950,111 F1079I probably benign Het
Adcy10 A T 1: 165,575,649 Q1572L possibly damaging Het
Akna T C 4: 63,394,609 T426A possibly damaging Het
Alkbh8 A G 9: 3,338,448 probably benign Het
Apc2 G A 10: 80,314,401 G1763E probably benign Het
Bmp1 G T 14: 70,490,173 R657S possibly damaging Het
Calm1 G A 12: 100,205,720 probably null Het
Ccdc150 C A 1: 54,272,485 A210E probably damaging Het
Cdc42bpa T C 1: 180,130,836 I275T Het
Cfap54 G T 10: 92,994,717 Q1186K probably benign Het
Col6a6 A G 9: 105,781,970 V592A probably benign Het
Colec11 A T 12: 28,594,855 N213K possibly damaging Het
Dennd5b G A 6: 149,033,346 R676* probably null Het
Dnaaf5 T G 5: 139,152,897 Y278D probably damaging Het
Dopey1 T A 9: 86,489,743 Y162* probably null Het
Dync1li2 A G 8: 104,423,623 L369P possibly damaging Het
Ebf1 A G 11: 44,992,449 T505A probably benign Het
Ebf1 A G 11: 45,004,721 I584M probably benign Het
Frmpd1 T C 4: 45,285,367 L1396P probably damaging Het
Gm2075 A G 12: 88,012,016 R57G probably damaging Het
Gprin1 C T 13: 54,737,788 R891H probably damaging Het
Gsap G A 5: 21,217,473 V147I probably damaging Het
Gsc G T 12: 104,472,861 Y85* probably null Het
Gtf2a1l A G 17: 88,668,724 N5S Het
Hmcn2 T C 2: 31,391,509 V1912A possibly damaging Het
Icos G T 1: 60,995,555 S179I probably damaging Het
Ifi209 T C 1: 173,637,403 L33P probably damaging Het
Igsf10 A G 3: 59,326,059 I1751T possibly damaging Het
Il31ra T C 13: 112,541,246 Y252C probably damaging Het
Ints6 A T 14: 62,709,587 S310T probably damaging Het
Kcng1 A T 2: 168,269,185 S20T possibly damaging Het
Klf15 T C 6: 90,467,109 I222T probably damaging Het
Lmo7 A T 14: 101,807,470 K53* probably null Het
Map10 C A 8: 125,670,910 N347K probably damaging Het
Mrps11 C A 7: 78,790,696 T111K probably damaging Het
Myom3 T G 4: 135,779,399 D494E probably benign Het
Naalad2 T A 9: 18,330,856 Y584F probably damaging Het
Ndufa9 A G 6: 126,849,087 V9A probably benign Het
Nrcam G T 12: 44,568,546 V640F possibly damaging Het
Olfr248 C T 1: 174,391,663 T198I probably benign Het
Olfr330 C A 11: 58,529,647 G113V probably damaging Het
Olfr646 T C 7: 104,106,513 M78T probably benign Het
Olfr993 G A 2: 85,414,504 A125V probably damaging Het
Pcdhga8 T A 18: 37,727,839 H649Q probably benign Het
Pdk1 C A 2: 71,900,058 H413Q probably benign Het
Pfkm T A 15: 98,129,280 H611Q probably damaging Het
Polr3g T C 13: 81,694,416 Y160C unknown Het
Ppargc1b A T 18: 61,310,922 M406K probably benign Het
Ptf1a C T 2: 19,445,725 probably benign Het
Rc3h2 A T 2: 37,405,252 C251S possibly damaging Het
Rnf32 A G 5: 29,206,213 T166A possibly damaging Het
Sav1 A T 12: 69,976,016 V254E probably damaging Het
Sel1l T C 12: 91,830,752 N234D probably benign Het
Setd1a C T 7: 127,786,418 P766S possibly damaging Het
Skida1 T A 2: 18,045,678 K801* probably null Het
Slc22a5 G A 11: 53,883,721 T146I probably benign Het
Slc25a24 G T 3: 109,156,952 A206S possibly damaging Het
Slc39a6 G A 18: 24,600,913 R240W probably damaging Het
Ssc5d T A 7: 4,927,059 D46E probably damaging Het
St5 C T 7: 109,557,084 G153D probably benign Het
Tekt4 C T 17: 25,471,927 A69V possibly damaging Het
Tmigd1 T A 11: 76,914,052 F239Y probably benign Het
Tpp1 T A 7: 105,751,639 R60S probably benign Het
Trank1 A T 9: 111,367,200 I1431F probably damaging Het
Trav15-1-dv6-1 G T 14: 53,560,062 W56L probably damaging Het
Ugt2b38 A G 5: 87,420,537 S300P probably damaging Het
Urah T A 7: 140,837,674 L119Q unknown Het
Uspl1 T A 5: 149,204,338 F382L probably damaging Het
Vps9d1 T A 8: 123,248,835 Q157L probably damaging Het
Wbp1l G A 19: 46,652,494 V88I probably benign Het
Zfp444 T C 7: 6,188,158 S113P probably damaging Het
Zfp580 T G 7: 5,053,153 S171A possibly damaging Het
Zfp607a A G 7: 27,877,957 I151V probably benign Het
Zfp827 T C 8: 79,091,935 F614S probably damaging Het
Zic4 A T 9: 91,378,860 Q56L possibly damaging Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 splice site probably null
R4305:Gart UTSW 16 91633992 missense possibly damaging 0.48
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
R9046:Gart UTSW 16 91621673 missense probably damaging 1.00
R9514:Gart UTSW 16 91630708 missense probably benign 0.03
R9753:Gart UTSW 16 91634061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGACTTAAAACGGAACTAGC -3'
(R):5'- GCCTGCTCTACATAGTAAAGACC -3'

Sequencing Primer
(F):5'- AACTAGCCGAGTTTCCTCCCAG -3'
(R):5'- TGCTCTACATAGTAAAGACCCTGTC -3'
Posted On 2022-02-07