Incidental Mutation 'R9179:Scel'
ID 696912
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9179 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103574400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 288 (L288P)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect possibly damaging
Transcript: ENSMUST00000095576
AA Change: L288P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: L288P

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227322
AA Change: L288P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik T A 6: 124,356,923 M33L probably benign Het
2310003L06Rik A G 5: 87,972,031 T216A probably benign Het
5430403G16Rik A G 5: 109,675,842 C581R probably damaging Het
9330161L09Rik A C 12: 103,407,578 C12G unknown Het
Ahdc1 T A 4: 133,061,618 F57I possibly damaging Het
Amotl1 C A 9: 14,550,491 A809S possibly damaging Het
Ankfn1 C T 11: 89,523,185 M121I probably benign Het
Aspm A G 1: 139,476,715 D1261G probably damaging Het
Axl T C 7: 25,770,233 T502A probably damaging Het
Catsperd G A 17: 56,661,252 D546N probably benign Het
Ccdc102a A G 8: 94,913,120 V182A possibly damaging Het
Cdh23 C T 10: 60,317,885 A2309T probably benign Het
Cfap69 A T 5: 5,626,064 N210K probably benign Het
Cnot1 A G 8: 95,773,426 S147P probably benign Het
Cntnap5c T C 17: 58,293,917 S752P probably benign Het
Cyp3a41a A T 5: 145,705,844 M235K probably benign Het
Cyp4f15 A G 17: 32,700,211 D336G possibly damaging Het
Dagla A G 19: 10,251,161 I631T possibly damaging Het
Dph6 C T 2: 114,523,110 C199Y probably damaging Het
Ermard T A 17: 15,053,233 L360Q probably damaging Het
F830045P16Rik T C 2: 129,472,788 T190A probably benign Het
Fgfr3 G T 5: 33,729,972 V212L possibly damaging Het
Flnb C A 14: 7,887,541 C450* probably null Het
Gls T C 1: 52,199,856 Y362C probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Gns T C 10: 121,380,175 F276L Het
Grin2d A G 7: 45,856,752 S572P probably damaging Het
Impa2 C T 18: 67,289,403 probably benign Het
Itgal A T 7: 127,306,711 D355V probably benign Het
Kdm6b A T 11: 69,406,695 probably null Het
Klk1b1 T A 7: 43,969,291 C31S probably damaging Het
Ldb3 A T 14: 34,555,355 V354E probably benign Het
Mettl21c T A 1: 44,009,982 Y135F probably benign Het
Mocs1 A G 17: 49,433,275 T77A probably damaging Het
Ndufs1 T C 1: 63,170,115 N30D probably benign Het
Olfr1243 T A 2: 89,528,150 K87* probably null Het
Olfr339 T C 2: 36,422,114 S239P probably damaging Het
Otog C A 7: 46,288,461 P1865T possibly damaging Het
Pabpc1l T C 2: 164,031,220 S137P probably damaging Het
Pilrb1 C A 5: 137,857,395 W78L probably damaging Het
Plekha6 A G 1: 133,286,347 Y832C possibly damaging Het
Ppan C A 9: 20,891,903 Q424K probably benign Het
Ppp1r12a T A 10: 108,251,921 N544K probably damaging Het
Pramef25 T C 4: 143,949,724 E270G probably benign Het
Pstpip2 A G 18: 77,873,455 D246G possibly damaging Het
Rasef G A 4: 73,744,119 T198I probably damaging Het
Rbm12 T C 2: 156,096,543 H603R probably benign Het
Rims1 T C 1: 22,412,266 R179G probably damaging Het
Sel1l A T 12: 91,811,952 D696E probably benign Het
Slc4a8 A G 15: 100,791,601 K416R possibly damaging Het
Tmem132b A T 5: 125,623,051 M218L probably benign Het
Tnrc6a T C 7: 123,192,658 S1800P probably benign Het
Tpcn1 A C 5: 120,541,950 L576R probably damaging Het
Vmn2r34 T G 7: 7,672,724 Q555P possibly damaging Het
Vwa8 C T 14: 79,098,361 T1419I probably benign Het
Xrn2 T C 2: 147,013,161 Y14H probably benign Het
Zfyve28 A T 5: 34,225,032 D241E probably benign Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATCAAGGTGTTGCCACTTGAATTAG -3'
(R):5'- GGCAGATATGCATGGCCATC -3'

Sequencing Primer
(F):5'- GCCACTTGAATTAGGTATTTCTGAG -3'
(R):5'- GCAGATATGCATGGCCATCCTTTAG -3'
Posted On 2022-02-07