Incidental Mutation 'R9180:Muc16'
ID 696965
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9180 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 18642742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 4085 (V4085G)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: V4085G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,031,747 L211P probably damaging Het
4930579F01Rik G A 3: 138,183,709 P49L probably benign Het
Anapc2 C T 2: 25,273,291 T180I probably benign Het
Ankib1 A T 5: 3,706,276 H556Q probably damaging Het
Aox2 A T 1: 58,339,618 K1009* probably null Het
Apob C T 12: 7,997,925 P968L probably damaging Het
Bpi T A 2: 158,274,688 F335Y probably benign Het
Cabcoco1 T C 10: 68,436,889 Y222C probably damaging Het
Camk2b G T 11: 5,989,332 C273* probably null Het
Catsperd G A 17: 56,661,252 D546N probably benign Het
Cenpb C T 2: 131,179,543 G112S probably damaging Het
Col6a5 A G 9: 105,861,979 L2585P probably damaging Het
Cop1 A G 1: 159,319,769 E555G probably damaging Het
Coro1b T C 19: 4,153,393 V411A probably benign Het
Cyfip2 G A 11: 46,286,093 R87C probably damaging Het
Dthd1 A C 5: 62,888,067 I725L probably benign Het
Dydc1 A C 14: 41,078,097 E20A probably damaging Het
Ermp1 T C 19: 29,632,445 I317V probably benign Het
Fat4 A G 3: 38,888,407 N483S possibly damaging Het
Fbxo33 A G 12: 59,204,309 probably null Het
Fcgbp G T 7: 28,103,773 E1601* probably null Het
Fer1l5 A T 1: 36,410,918 S1118C probably null Het
Fer1l6 T C 15: 58,622,381 V1141A probably benign Het
Flnb C T 14: 7,818,219 T23M probably damaging Het
Fsip2 T C 2: 82,985,230 L3769P possibly damaging Het
Gm5346 T A 8: 43,626,933 R85* probably null Het
Gna11 T C 10: 81,535,108 K98R Het
Gpat3 A T 5: 100,884,364 T176S probably benign Het
Gprc5b A G 7: 118,984,319 L109P probably damaging Het
Hadha A T 5: 30,135,040 N246K probably benign Het
Haus3 G A 5: 34,167,491 Q275* probably null Het
Higd1b A G 11: 102,837,264 Y44C possibly damaging Het
Igkv1-131 T C 6: 67,766,234 K55R probably benign Het
Igtp G T 11: 58,207,265 E421* probably null Het
Kcnk3 G T 5: 30,588,188 probably benign Het
Krtap4-13 A T 11: 99,809,339 C165S unknown Het
Lrfn4 T C 19: 4,613,325 R394G probably benign Het
Lrrc7 A C 3: 158,161,374 L910R possibly damaging Het
Mbtd1 A G 11: 93,932,392 D568G probably damaging Het
Mettl16 T A 11: 74,803,000 I279N probably benign Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Mrgprg T C 7: 143,764,613 K254R probably benign Het
Mvp T C 7: 126,992,650 Q456R probably benign Het
Myf6 T C 10: 107,493,457 D209G probably benign Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr1032 T G 2: 86,007,981 D68E probably damaging Het
Olfr323 A G 11: 58,625,236 L270P probably benign Het
Olfr365 A G 2: 37,201,280 D13G probably benign Het
Olfr560 T A 7: 102,753,527 Y134F probably damaging Het
Olfr786 T C 10: 129,436,989 F59S probably damaging Het
Phf20 A G 2: 156,272,617 D295G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1r13b A T 12: 111,844,982 H157Q probably benign Het
Rbm26 C T 14: 105,153,603 R149H unknown Het
Reg3d C T 6: 78,378,460 C16Y possibly damaging Het
Rrp36 A G 17: 46,668,054 F193L possibly damaging Het
Rtca A T 3: 116,489,256 M361K probably benign Het
Ryr3 T G 2: 112,661,636 D3790A probably damaging Het
Serpina3n C A 12: 104,411,181 A231E probably benign Het
Sh2d2a A G 3: 87,851,763 D224G possibly damaging Het
Sh3bp2 A T 5: 34,561,033 K526* probably null Het
Slc12a2 A G 18: 57,936,397 T1017A possibly damaging Het
Slc12a8 T C 16: 33,541,027 L93P probably damaging Het
Slc5a6 A G 5: 31,037,846 I469T probably damaging Het
Smarcc1 T A 9: 110,135,660 V95D probably damaging Het
Snap29 T A 16: 17,406,299 S59R probably damaging Het
Tmem121b T A 6: 120,492,823 Y311F probably damaging Het
Tpcn1 C A 5: 120,555,935 V199L probably benign Het
Ttn T C 2: 76,788,377 I16188V probably benign Het
Usp24 T C 4: 106,359,050 I366T possibly damaging Het
Utrn T A 10: 12,669,719 E1727D probably damaging Het
Vav2 T C 2: 27,292,689 D301G probably damaging Het
Vmn2r104 T C 17: 20,042,825 T125A probably benign Het
Vmn2r73 T G 7: 85,857,915 I730L probably benign Het
Zfp352 A T 4: 90,224,881 K419N probably benign Het
Zfp84 C A 7: 29,775,448 S48R probably damaging Het
Zfp947 A T 17: 22,145,405 H429Q probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R7038_muc16_859 UTSW 9 18620468 missense probably damaging 0.99
Runneymeade UTSW 9 18579317 critical splice donor site probably null
slimey UTSW 9 18590698 missense probably damaging 1.00
viscous UTSW 9 18644732 missense unknown
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
R8679:Muc16 UTSW 9 18646448 missense unknown
R8680:Muc16 UTSW 9 18644719 missense unknown
R8720:Muc16 UTSW 9 18641600 missense probably benign 0.01
R8729:Muc16 UTSW 9 18660050 missense unknown
R8736:Muc16 UTSW 9 18550843 nonsense probably null
R8739:Muc16 UTSW 9 18637298 missense probably benign 0.10
R8807:Muc16 UTSW 9 18656057 missense unknown
R8830:Muc16 UTSW 9 18646069 missense unknown
R8871:Muc16 UTSW 9 18656048 missense unknown
R8884:Muc16 UTSW 9 18644200 missense unknown
R8923:Muc16 UTSW 9 18638676 missense probably benign 0.01
R8948:Muc16 UTSW 9 18647233 missense unknown
R8949:Muc16 UTSW 9 18520925 critical splice donor site probably null
R8987:Muc16 UTSW 9 18551685 nonsense probably null
R8997:Muc16 UTSW 9 18607467 intron probably benign
R9013:Muc16 UTSW 9 18512773 missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18638719 small insertion probably benign
R9036:Muc16 UTSW 9 18644679 missense unknown
R9040:Muc16 UTSW 9 18644786 nonsense probably null
R9065:Muc16 UTSW 9 18643009 missense unknown
R9089:Muc16 UTSW 9 18644550 missense unknown
R9098:Muc16 UTSW 9 18643679 missense unknown
R9100:Muc16 UTSW 9 18645670 missense unknown
R9128:Muc16 UTSW 9 18647582 missense unknown
R9169:Muc16 UTSW 9 18656528 missense unknown
R9191:Muc16 UTSW 9 18644810 missense unknown
R9203:Muc16 UTSW 9 18551688 missense unknown
R9208:Muc16 UTSW 9 18508537 missense probably damaging 0.99
R9232:Muc16 UTSW 9 18656040 missense unknown
R9240:Muc16 UTSW 9 18538013 missense unknown
R9254:Muc16 UTSW 9 18646171 missense unknown
R9330:Muc16 UTSW 9 18641036 missense probably benign 0.04
R9347:Muc16 UTSW 9 18660215 missense unknown
R9358:Muc16 UTSW 9 18642224 missense probably benign 0.01
R9359:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9379:Muc16 UTSW 9 18646171 missense unknown
R9403:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9422:Muc16 UTSW 9 18641806 missense probably benign 0.01
R9433:Muc16 UTSW 9 18572641 missense probably benign 0.09
R9438:Muc16 UTSW 9 18647732 missense unknown
R9442:Muc16 UTSW 9 18655328 missense unknown
R9453:Muc16 UTSW 9 18660765 missense unknown
R9467:Muc16 UTSW 9 18597035 missense probably benign 0.03
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTGATCTACGAAAATCCCC -3'
(R):5'- GCAGGATATCTCTACTGGCAAAG -3'

Sequencing Primer
(F):5'- GATCTACGAAAATCCCCATTGTAG -3'
(R):5'- TCTCTACTGGCAAAGCAAAAGTGTC -3'
Posted On 2022-02-07