Incidental Mutation 'R9180:Utrn'
ID 696968
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Name utrophin
Synonyms G-utrophin, Dmdl, DRP
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9180 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 12257932-12745109 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12545463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1727 (E1727D)
Ref Sequence ENSEMBL: ENSMUSP00000076093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076817
AA Change: E1727D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: E1727D

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218635
AA Change: E1727D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 137,889,470 (GRCm39) P49L probably benign Het
Adam34l T A 8: 44,079,970 (GRCm39) R85* probably null Het
Anapc2 C T 2: 25,163,303 (GRCm39) T180I probably benign Het
Ankib1 A T 5: 3,756,276 (GRCm39) H556Q probably damaging Het
Aox1 A T 1: 58,378,777 (GRCm39) K1009* probably null Het
Apob C T 12: 8,047,925 (GRCm39) P968L probably damaging Het
Bpi T A 2: 158,116,608 (GRCm39) F335Y probably benign Het
Cabcoco1 T C 10: 68,272,719 (GRCm39) Y222C probably damaging Het
Camk2b G T 11: 5,939,332 (GRCm39) C273* probably null Het
Catsperd G A 17: 56,968,252 (GRCm39) D546N probably benign Het
Cenpb C T 2: 131,021,463 (GRCm39) G112S probably damaging Het
Col6a5 A G 9: 105,739,178 (GRCm39) L2585P probably damaging Het
Cop1 A G 1: 159,147,339 (GRCm39) E555G probably damaging Het
Coro1b T C 19: 4,203,392 (GRCm39) V411A probably benign Het
Cyfip2 G A 11: 46,176,920 (GRCm39) R87C probably damaging Het
Dthd1 A C 5: 63,045,410 (GRCm39) I725L probably benign Het
Dydc1 A C 14: 40,800,054 (GRCm39) E20A probably damaging Het
Ermp1 T C 19: 29,609,845 (GRCm39) I317V probably benign Het
Fat4 A G 3: 38,942,556 (GRCm39) N483S possibly damaging Het
Fbxo33 A G 12: 59,251,095 (GRCm39) probably null Het
Fcgbp G T 7: 27,803,198 (GRCm39) E1601* probably null Het
Fer1l5 A T 1: 36,449,999 (GRCm39) S1118C probably null Het
Fer1l6 T C 15: 58,494,230 (GRCm39) V1141A probably benign Het
Flnb C T 14: 7,818,219 (GRCm38) T23M probably damaging Het
Fsip2 T C 2: 82,815,574 (GRCm39) L3769P possibly damaging Het
Gna11 T C 10: 81,370,942 (GRCm39) K98R Het
Gpat3 A T 5: 101,032,230 (GRCm39) T176S probably benign Het
Gprc5b A G 7: 118,583,542 (GRCm39) L109P probably damaging Het
Hadha A T 5: 30,340,038 (GRCm39) N246K probably benign Het
Haus3 G A 5: 34,324,835 (GRCm39) Q275* probably null Het
Higd1b A G 11: 102,728,090 (GRCm39) Y44C possibly damaging Het
Igkv1-131 T C 6: 67,743,218 (GRCm39) K55R probably benign Het
Igtp G T 11: 58,098,091 (GRCm39) E421* probably null Het
Kcnk3 G T 5: 30,745,532 (GRCm39) probably benign Het
Krtap4-13 A T 11: 99,700,165 (GRCm39) C165S unknown Het
Lrfn4 T C 19: 4,663,353 (GRCm39) R394G probably benign Het
Lrrc7 A C 3: 157,867,011 (GRCm39) L910R possibly damaging Het
Mbtd1 A G 11: 93,823,218 (GRCm39) D568G probably damaging Het
Mettl16 T A 11: 74,693,826 (GRCm39) I279N probably benign Het
Mmrn2 A G 14: 34,121,158 (GRCm39) H676R probably benign Het
Mrgprg T C 7: 143,318,350 (GRCm39) K254R probably benign Het
Muc16 A C 9: 18,554,038 (GRCm39) V4085G unknown Het
Mvp T C 7: 126,591,822 (GRCm39) Q456R probably benign Het
Myf6 T C 10: 107,329,318 (GRCm39) D209G probably benign Het
Ociad1 A G 5: 73,467,725 (GRCm39) D167G probably benign Het
Or11l3 A G 11: 58,516,062 (GRCm39) L270P probably benign Het
Or1l4 A G 2: 37,091,292 (GRCm39) D13G probably benign Het
Or51f23b T A 7: 102,402,734 (GRCm39) Y134F probably damaging Het
Or5m3 T G 2: 85,838,325 (GRCm39) D68E probably damaging Het
Or6c1b T C 10: 129,272,858 (GRCm39) F59S probably damaging Het
Phf20 A G 2: 156,114,537 (GRCm39) D295G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp1r13b A T 12: 111,811,416 (GRCm39) H157Q probably benign Het
Prss3b A G 6: 41,008,681 (GRCm39) L211P probably damaging Het
Rbm26 C T 14: 105,391,039 (GRCm39) R149H unknown Het
Reg3d C T 6: 78,355,443 (GRCm39) C16Y possibly damaging Het
Rrp36 A G 17: 46,978,980 (GRCm39) F193L possibly damaging Het
Rtca A T 3: 116,282,905 (GRCm39) M361K probably benign Het
Ryr3 T G 2: 112,491,981 (GRCm39) D3790A probably damaging Het
Serpina3n C A 12: 104,377,440 (GRCm39) A231E probably benign Het
Sh2d2a A G 3: 87,759,070 (GRCm39) D224G possibly damaging Het
Sh3bp2 A T 5: 34,718,377 (GRCm39) K526* probably null Het
Slc12a2 A G 18: 58,069,469 (GRCm39) T1017A possibly damaging Het
Slc12a8 T C 16: 33,361,397 (GRCm39) L93P probably damaging Het
Slc5a6 A G 5: 31,195,190 (GRCm39) I469T probably damaging Het
Smarcc1 T A 9: 109,964,728 (GRCm39) V95D probably damaging Het
Snap29 T A 16: 17,224,163 (GRCm39) S59R probably damaging Het
Tmem121b T A 6: 120,469,784 (GRCm39) Y311F probably damaging Het
Tpcn1 C A 5: 120,694,000 (GRCm39) V199L probably benign Het
Ttn T C 2: 76,618,721 (GRCm39) I16188V probably benign Het
Usp24 T C 4: 106,216,247 (GRCm39) I366T possibly damaging Het
Vav2 T C 2: 27,182,701 (GRCm39) D301G probably damaging Het
Vmn2r104 T C 17: 20,263,087 (GRCm39) T125A probably benign Het
Vmn2r73 T G 7: 85,507,123 (GRCm39) I730L probably benign Het
Zfp352 A T 4: 90,113,118 (GRCm39) K419N probably benign Het
Zfp84 C A 7: 29,474,873 (GRCm39) S48R probably damaging Het
Zfp947 A T 17: 22,364,386 (GRCm39) H429Q probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12,547,574 (GRCm39) missense probably damaging 1.00
IGL00469:Utrn APN 10 12,282,273 (GRCm39) missense probably damaging 1.00
IGL00518:Utrn APN 10 12,542,587 (GRCm39) splice site probably benign
IGL00560:Utrn APN 10 12,331,211 (GRCm39) nonsense probably null
IGL00589:Utrn APN 10 12,554,362 (GRCm39) missense possibly damaging 0.53
IGL00662:Utrn APN 10 12,540,705 (GRCm39) missense probably damaging 0.99
IGL00754:Utrn APN 10 12,539,236 (GRCm39) missense probably benign 0.05
IGL00772:Utrn APN 10 12,524,929 (GRCm39) missense probably benign
IGL00775:Utrn APN 10 12,620,974 (GRCm39) critical splice donor site probably null
IGL00782:Utrn APN 10 12,528,555 (GRCm39) missense probably benign 0.13
IGL00962:Utrn APN 10 12,357,078 (GRCm39) missense possibly damaging 0.80
IGL01584:Utrn APN 10 12,602,111 (GRCm39) missense probably benign 0.01
IGL01677:Utrn APN 10 12,619,901 (GRCm39) missense probably damaging 1.00
IGL01695:Utrn APN 10 12,621,086 (GRCm39) missense probably benign 0.00
IGL01743:Utrn APN 10 12,587,301 (GRCm39) missense possibly damaging 0.94
IGL01815:Utrn APN 10 12,528,460 (GRCm39) missense probably benign 0.00
IGL01901:Utrn APN 10 12,516,672 (GRCm39) missense probably damaging 1.00
IGL01982:Utrn APN 10 12,623,773 (GRCm39) missense probably damaging 1.00
IGL01983:Utrn APN 10 12,545,525 (GRCm39) missense probably benign 0.18
IGL02031:Utrn APN 10 12,610,948 (GRCm39) missense probably damaging 1.00
IGL02106:Utrn APN 10 12,289,717 (GRCm39) missense possibly damaging 0.92
IGL02134:Utrn APN 10 12,519,163 (GRCm39) missense probably damaging 0.99
IGL02209:Utrn APN 10 12,559,039 (GRCm39) missense probably damaging 0.97
IGL02217:Utrn APN 10 12,627,303 (GRCm39) missense probably damaging 1.00
IGL02250:Utrn APN 10 12,312,135 (GRCm39) missense probably damaging 1.00
IGL02307:Utrn APN 10 12,625,809 (GRCm39) nonsense probably null
IGL02386:Utrn APN 10 12,297,352 (GRCm39) missense possibly damaging 0.91
IGL02494:Utrn APN 10 12,585,798 (GRCm39) missense probably benign
IGL02631:Utrn APN 10 12,585,807 (GRCm39) missense probably benign 0.00
IGL02729:Utrn APN 10 12,596,554 (GRCm39) unclassified probably benign
IGL02736:Utrn APN 10 12,297,384 (GRCm39) missense probably damaging 1.00
IGL02832:Utrn APN 10 12,613,937 (GRCm39) missense possibly damaging 0.82
IGL02926:Utrn APN 10 12,566,504 (GRCm39) missense probably damaging 0.96
IGL03184:Utrn APN 10 12,585,910 (GRCm39) missense probably benign 0.04
IGL03194:Utrn APN 10 12,282,173 (GRCm39) splice site probably benign
IGL03346:Utrn APN 10 12,401,096 (GRCm39) missense probably benign 0.22
retiring UTSW 10 12,516,764 (GRCm39) missense probably damaging 1.00
shrinking_violet UTSW 10 12,587,329 (GRCm39) critical splice acceptor site probably null
Wallflower UTSW 10 12,623,719 (GRCm39) missense probably damaging 1.00
FR4548:Utrn UTSW 10 12,509,685 (GRCm39) critical splice donor site probably benign
I2288:Utrn UTSW 10 12,297,384 (GRCm39) missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12,542,448 (GRCm39) missense probably benign 0.06
R0022:Utrn UTSW 10 12,585,700 (GRCm39) splice site probably benign
R0024:Utrn UTSW 10 12,281,755 (GRCm39) missense probably benign 0.00
R0024:Utrn UTSW 10 12,281,755 (GRCm39) missense probably benign 0.00
R0026:Utrn UTSW 10 12,601,940 (GRCm39) splice site probably benign
R0026:Utrn UTSW 10 12,601,940 (GRCm39) splice site probably benign
R0091:Utrn UTSW 10 12,610,948 (GRCm39) missense probably damaging 1.00
R0112:Utrn UTSW 10 12,562,209 (GRCm39) nonsense probably null
R0126:Utrn UTSW 10 12,587,219 (GRCm39) missense probably benign 0.02
R0184:Utrn UTSW 10 12,543,362 (GRCm39) missense probably benign
R0219:Utrn UTSW 10 12,560,195 (GRCm39) missense probably damaging 1.00
R0369:Utrn UTSW 10 12,509,766 (GRCm39) missense probably benign 0.37
R0390:Utrn UTSW 10 12,585,804 (GRCm39) missense probably benign 0.05
R0391:Utrn UTSW 10 12,401,077 (GRCm39) splice site probably benign
R0408:Utrn UTSW 10 12,259,934 (GRCm39) makesense probably null
R0409:Utrn UTSW 10 12,519,345 (GRCm39) missense probably benign 0.01
R0441:Utrn UTSW 10 12,564,038 (GRCm39) missense probably null 0.88
R0504:Utrn UTSW 10 12,278,639 (GRCm39) missense probably benign 0.02
R0730:Utrn UTSW 10 12,573,902 (GRCm39) splice site probably benign
R1078:Utrn UTSW 10 12,331,310 (GRCm39) critical splice acceptor site probably null
R1171:Utrn UTSW 10 12,357,052 (GRCm39) missense probably damaging 0.99
R1191:Utrn UTSW 10 12,509,777 (GRCm39) missense probably benign 0.02
R1203:Utrn UTSW 10 12,362,281 (GRCm39) missense probably damaging 1.00
R1401:Utrn UTSW 10 12,524,897 (GRCm39) missense probably benign
R1418:Utrn UTSW 10 12,589,094 (GRCm39) missense probably benign
R1439:Utrn UTSW 10 12,619,793 (GRCm39) missense possibly damaging 0.79
R1441:Utrn UTSW 10 12,559,039 (GRCm39) missense probably damaging 0.97
R1445:Utrn UTSW 10 12,554,318 (GRCm39) splice site probably benign
R1509:Utrn UTSW 10 12,331,185 (GRCm39) missense possibly damaging 0.91
R1546:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1585:Utrn UTSW 10 12,312,029 (GRCm39) missense possibly damaging 0.62
R1621:Utrn UTSW 10 12,589,027 (GRCm39) missense probably benign 0.24
R1637:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1703:Utrn UTSW 10 12,603,473 (GRCm39) splice site probably benign
R1725:Utrn UTSW 10 12,539,263 (GRCm39) missense probably damaging 0.99
R1735:Utrn UTSW 10 12,585,882 (GRCm39) missense probably benign
R1770:Utrn UTSW 10 12,351,040 (GRCm39) missense probably damaging 0.98
R1778:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R1783:Utrn UTSW 10 12,339,083 (GRCm39) missense probably damaging 1.00
R1818:Utrn UTSW 10 12,585,708 (GRCm39) critical splice donor site probably null
R1829:Utrn UTSW 10 12,351,018 (GRCm39) missense probably damaging 1.00
R1919:Utrn UTSW 10 12,331,224 (GRCm39) missense probably benign 0.15
R1964:Utrn UTSW 10 12,560,181 (GRCm39) missense probably damaging 1.00
R2080:Utrn UTSW 10 12,612,826 (GRCm39) missense probably benign 0.36
R2092:Utrn UTSW 10 12,554,442 (GRCm39) missense probably benign 0.12
R2107:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R2108:Utrn UTSW 10 12,312,108 (GRCm39) missense probably damaging 1.00
R2760:Utrn UTSW 10 12,566,622 (GRCm39) missense probably damaging 1.00
R2884:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2885:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2886:Utrn UTSW 10 12,615,105 (GRCm39) splice site probably null
R2903:Utrn UTSW 10 12,519,172 (GRCm39) missense probably damaging 1.00
R2944:Utrn UTSW 10 12,519,163 (GRCm39) missense probably damaging 1.00
R2945:Utrn UTSW 10 12,362,135 (GRCm39) missense possibly damaging 0.50
R3438:Utrn UTSW 10 12,357,062 (GRCm39) missense probably damaging 0.98
R3683:Utrn UTSW 10 12,542,579 (GRCm39) missense probably benign 0.10
R3735:Utrn UTSW 10 12,354,228 (GRCm39) missense probably damaging 1.00
R3907:Utrn UTSW 10 12,585,926 (GRCm39) splice site probably benign
R3923:Utrn UTSW 10 12,615,223 (GRCm39) missense probably benign 0.23
R3925:Utrn UTSW 10 12,573,786 (GRCm39) missense probably benign
R3926:Utrn UTSW 10 12,573,786 (GRCm39) missense probably benign
R3938:Utrn UTSW 10 12,625,774 (GRCm39) critical splice donor site probably null
R3941:Utrn UTSW 10 12,587,329 (GRCm39) critical splice acceptor site probably null
R3958:Utrn UTSW 10 12,625,852 (GRCm39) missense probably damaging 1.00
R4091:Utrn UTSW 10 12,585,915 (GRCm39) missense probably benign 0.10
R4454:Utrn UTSW 10 12,603,584 (GRCm39) missense possibly damaging 0.81
R4585:Utrn UTSW 10 12,564,050 (GRCm39) missense probably benign 0.01
R4667:Utrn UTSW 10 12,573,797 (GRCm39) missense probably benign 0.22
R4684:Utrn UTSW 10 12,620,984 (GRCm39) missense probably damaging 1.00
R4782:Utrn UTSW 10 12,625,813 (GRCm39) missense probably damaging 1.00
R4785:Utrn UTSW 10 12,530,489 (GRCm39) missense probably benign 0.39
R4799:Utrn UTSW 10 12,625,813 (GRCm39) missense probably damaging 1.00
R4829:Utrn UTSW 10 12,539,205 (GRCm39) missense probably benign 0.00
R4878:Utrn UTSW 10 12,603,502 (GRCm39) missense probably damaging 1.00
R4955:Utrn UTSW 10 12,737,311 (GRCm39) critical splice donor site probably null
R4967:Utrn UTSW 10 12,331,164 (GRCm39) missense probably damaging 0.99
R5071:Utrn UTSW 10 12,259,948 (GRCm39) splice site probably null
R5072:Utrn UTSW 10 12,259,948 (GRCm39) splice site probably null
R5186:Utrn UTSW 10 12,604,521 (GRCm39) missense probably damaging 1.00
R5213:Utrn UTSW 10 12,512,504 (GRCm39) missense probably damaging 1.00
R5296:Utrn UTSW 10 12,277,099 (GRCm39) missense probably damaging 1.00
R5309:Utrn UTSW 10 12,603,513 (GRCm39) missense probably damaging 1.00
R5312:Utrn UTSW 10 12,603,513 (GRCm39) missense probably damaging 1.00
R5399:Utrn UTSW 10 12,516,727 (GRCm39) missense probably damaging 1.00
R5407:Utrn UTSW 10 12,556,369 (GRCm39) missense probably damaging 1.00
R5411:Utrn UTSW 10 12,524,929 (GRCm39) missense probably benign
R5428:Utrn UTSW 10 12,569,175 (GRCm39) missense probably benign 0.09
R5595:Utrn UTSW 10 12,558,062 (GRCm39) missense possibly damaging 0.89
R5602:Utrn UTSW 10 12,625,839 (GRCm39) missense probably damaging 1.00
R5608:Utrn UTSW 10 12,547,581 (GRCm39) missense probably benign 0.00
R5678:Utrn UTSW 10 12,317,762 (GRCm39) missense probably damaging 1.00
R5726:Utrn UTSW 10 12,545,550 (GRCm39) missense probably benign
R5804:Utrn UTSW 10 12,297,369 (GRCm39) missense probably damaging 1.00
R5916:Utrn UTSW 10 12,540,795 (GRCm39) missense probably damaging 0.97
R5941:Utrn UTSW 10 12,362,227 (GRCm39) missense probably damaging 1.00
R6014:Utrn UTSW 10 12,566,620 (GRCm39) missense probably benign 0.01
R6015:Utrn UTSW 10 12,354,168 (GRCm39) missense possibly damaging 0.85
R6028:Utrn UTSW 10 12,530,460 (GRCm39) missense probably benign 0.00
R6158:Utrn UTSW 10 12,566,566 (GRCm39) missense probably benign 0.04
R6181:Utrn UTSW 10 12,615,200 (GRCm39) missense probably damaging 1.00
R6300:Utrn UTSW 10 12,377,220 (GRCm39) missense probably benign 0.35
R6367:Utrn UTSW 10 12,623,719 (GRCm39) missense probably damaging 1.00
R6377:Utrn UTSW 10 12,619,827 (GRCm39) missense probably damaging 1.00
R6434:Utrn UTSW 10 12,401,171 (GRCm39) missense probably damaging 1.00
R6498:Utrn UTSW 10 12,317,837 (GRCm39) missense probably benign
R6579:Utrn UTSW 10 12,623,750 (GRCm39) missense probably benign 0.05
R6704:Utrn UTSW 10 12,621,035 (GRCm39) missense probably damaging 0.99
R6736:Utrn UTSW 10 12,497,047 (GRCm39) missense probably benign 0.09
R6755:Utrn UTSW 10 12,574,831 (GRCm39) missense probably benign 0.00
R6793:Utrn UTSW 10 12,574,844 (GRCm39) missense possibly damaging 0.69
R6793:Utrn UTSW 10 12,516,669 (GRCm39) critical splice donor site probably null
R6835:Utrn UTSW 10 12,603,508 (GRCm39) missense probably damaging 1.00
R6919:Utrn UTSW 10 12,569,214 (GRCm39) nonsense probably null
R6920:Utrn UTSW 10 12,626,214 (GRCm39) missense probably damaging 0.98
R7037:Utrn UTSW 10 12,702,514 (GRCm39) splice site probably null
R7038:Utrn UTSW 10 12,558,082 (GRCm39) missense probably damaging 1.00
R7055:Utrn UTSW 10 12,623,665 (GRCm39) missense probably benign 0.23
R7072:Utrn UTSW 10 12,340,957 (GRCm39) missense probably damaging 1.00
R7090:Utrn UTSW 10 12,560,260 (GRCm39) missense possibly damaging 0.58
R7211:Utrn UTSW 10 12,277,079 (GRCm39) missense possibly damaging 0.72
R7248:Utrn UTSW 10 12,604,562 (GRCm39) missense possibly damaging 0.51
R7305:Utrn UTSW 10 12,261,280 (GRCm39) missense probably benign
R7334:Utrn UTSW 10 12,603,753 (GRCm39) splice site probably null
R7348:Utrn UTSW 10 12,623,762 (GRCm39) missense probably damaging 1.00
R7375:Utrn UTSW 10 12,516,764 (GRCm39) missense probably damaging 1.00
R7436:Utrn UTSW 10 12,315,535 (GRCm39) missense possibly damaging 0.72
R7476:Utrn UTSW 10 12,516,695 (GRCm39) missense probably benign
R7514:Utrn UTSW 10 12,573,833 (GRCm39) missense probably benign 0.00
R7527:Utrn UTSW 10 12,277,126 (GRCm39) missense possibly damaging 0.81
R7735:Utrn UTSW 10 12,619,787 (GRCm39) critical splice donor site probably null
R7748:Utrn UTSW 10 12,490,252 (GRCm39) missense probably benign 0.01
R7778:Utrn UTSW 10 12,362,354 (GRCm39) missense probably damaging 1.00
R7824:Utrn UTSW 10 12,362,354 (GRCm39) missense probably damaging 1.00
R7826:Utrn UTSW 10 12,277,050 (GRCm39) splice site probably null
R7872:Utrn UTSW 10 12,573,873 (GRCm39) missense probably benign
R7915:Utrn UTSW 10 12,340,956 (GRCm39) missense probably damaging 1.00
R7922:Utrn UTSW 10 12,543,271 (GRCm39) missense possibly damaging 0.68
R8081:Utrn UTSW 10 12,423,803 (GRCm39) start gained probably benign
R8132:Utrn UTSW 10 12,558,154 (GRCm39) missense probably damaging 0.99
R8167:Utrn UTSW 10 12,547,558 (GRCm39) nonsense probably null
R8186:Utrn UTSW 10 12,573,867 (GRCm39) missense probably benign
R8331:Utrn UTSW 10 12,490,363 (GRCm39) missense probably benign 0.00
R8352:Utrn UTSW 10 12,689,253 (GRCm39) missense probably benign 0.34
R8408:Utrn UTSW 10 12,545,887 (GRCm39) missense possibly damaging 0.69
R8452:Utrn UTSW 10 12,689,253 (GRCm39) missense probably benign 0.34
R8478:Utrn UTSW 10 12,524,892 (GRCm39) missense probably benign
R8489:Utrn UTSW 10 12,587,190 (GRCm39) missense probably benign 0.05
R8516:Utrn UTSW 10 12,362,254 (GRCm39) missense probably damaging 0.99
R8520:Utrn UTSW 10 12,545,930 (GRCm39) nonsense probably null
R8550:Utrn UTSW 10 12,689,329 (GRCm39) intron probably benign
R8856:Utrn UTSW 10 12,543,351 (GRCm39) missense probably benign
R8881:Utrn UTSW 10 12,423,737 (GRCm39) missense possibly damaging 0.46
R9186:Utrn UTSW 10 12,490,318 (GRCm39) missense probably benign
R9216:Utrn UTSW 10 12,689,229 (GRCm39) missense probably benign 0.19
R9251:Utrn UTSW 10 12,512,531 (GRCm39) missense probably benign 0.01
R9273:Utrn UTSW 10 12,509,707 (GRCm39) missense probably damaging 0.97
R9307:Utrn UTSW 10 12,554,475 (GRCm39) missense probably benign 0.02
R9344:Utrn UTSW 10 12,560,275 (GRCm39) missense probably benign 0.17
R9419:Utrn UTSW 10 12,564,125 (GRCm39) missense probably damaging 1.00
R9435:Utrn UTSW 10 12,519,173 (GRCm39) missense probably damaging 1.00
R9623:Utrn UTSW 10 12,282,225 (GRCm39) missense probably damaging 1.00
R9650:Utrn UTSW 10 12,613,929 (GRCm39) missense probably benign 0.00
R9653:Utrn UTSW 10 12,539,189 (GRCm39) missense probably benign 0.41
R9653:Utrn UTSW 10 12,497,123 (GRCm39) missense probably benign 0.17
R9672:Utrn UTSW 10 12,603,613 (GRCm39) missense possibly damaging 0.68
R9678:Utrn UTSW 10 12,615,159 (GRCm39) missense probably benign 0.00
R9741:Utrn UTSW 10 12,702,564 (GRCm39) missense probably benign
R9765:Utrn UTSW 10 12,610,921 (GRCm39) missense probably damaging 0.99
R9799:Utrn UTSW 10 12,585,736 (GRCm39) missense probably benign 0.01
RF009:Utrn UTSW 10 12,509,689 (GRCm39) nonsense probably null
V1662:Utrn UTSW 10 12,297,384 (GRCm39) missense probably damaging 1.00
X0018:Utrn UTSW 10 12,610,942 (GRCm39) missense probably damaging 1.00
Z1176:Utrn UTSW 10 12,564,173 (GRCm39) critical splice acceptor site probably null
Z1176:Utrn UTSW 10 12,558,104 (GRCm39) nonsense probably null
Z1177:Utrn UTSW 10 12,497,123 (GRCm39) missense probably benign 0.17
Z1177:Utrn UTSW 10 12,401,150 (GRCm39) nonsense probably null
Z1186:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1189:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1191:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Z1192:Utrn UTSW 10 12,545,491 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTGCTTTGCCAAACAG -3'
(R):5'- CTGAGAGTCTTCCTAGCAATCTCAG -3'

Sequencing Primer
(F):5'- GCTTTGCCAAACAGTTATTAAAATTC -3'
(R):5'- TTCATAGTAAGCATCTTGTGTGC -3'
Posted On 2022-02-07