Incidental Mutation 'R9180:Flnb'
ID 696985
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9180 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 7818219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 23 (T23M)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: T23M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: T23M

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A G 6: 41,031,747 L211P probably damaging Het
4930579F01Rik G A 3: 138,183,709 P49L probably benign Het
Anapc2 C T 2: 25,273,291 T180I probably benign Het
Ankib1 A T 5: 3,706,276 H556Q probably damaging Het
Aox2 A T 1: 58,339,618 K1009* probably null Het
Apob C T 12: 7,997,925 P968L probably damaging Het
Bpi T A 2: 158,274,688 F335Y probably benign Het
Cabcoco1 T C 10: 68,436,889 Y222C probably damaging Het
Camk2b G T 11: 5,989,332 C273* probably null Het
Catsperd G A 17: 56,661,252 D546N probably benign Het
Cenpb C T 2: 131,179,543 G112S probably damaging Het
Col6a5 A G 9: 105,861,979 L2585P probably damaging Het
Cop1 A G 1: 159,319,769 E555G probably damaging Het
Coro1b T C 19: 4,153,393 V411A probably benign Het
Cyfip2 G A 11: 46,286,093 R87C probably damaging Het
Dthd1 A C 5: 62,888,067 I725L probably benign Het
Dydc1 A C 14: 41,078,097 E20A probably damaging Het
Ermp1 T C 19: 29,632,445 I317V probably benign Het
Fat4 A G 3: 38,888,407 N483S possibly damaging Het
Fbxo33 A G 12: 59,204,309 probably null Het
Fcgbp G T 7: 28,103,773 E1601* probably null Het
Fer1l5 A T 1: 36,410,918 S1118C probably null Het
Fer1l6 T C 15: 58,622,381 V1141A probably benign Het
Fsip2 T C 2: 82,985,230 L3769P possibly damaging Het
Gm5346 T A 8: 43,626,933 R85* probably null Het
Gna11 T C 10: 81,535,108 K98R Het
Gpat3 A T 5: 100,884,364 T176S probably benign Het
Gprc5b A G 7: 118,984,319 L109P probably damaging Het
Hadha A T 5: 30,135,040 N246K probably benign Het
Haus3 G A 5: 34,167,491 Q275* probably null Het
Higd1b A G 11: 102,837,264 Y44C possibly damaging Het
Igkv1-131 T C 6: 67,766,234 K55R probably benign Het
Igtp G T 11: 58,207,265 E421* probably null Het
Kcnk3 G T 5: 30,588,188 probably benign Het
Krtap4-13 A T 11: 99,809,339 C165S unknown Het
Lrfn4 T C 19: 4,613,325 R394G probably benign Het
Lrrc7 A C 3: 158,161,374 L910R possibly damaging Het
Mbtd1 A G 11: 93,932,392 D568G probably damaging Het
Mettl16 T A 11: 74,803,000 I279N probably benign Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Mrgprg T C 7: 143,764,613 K254R probably benign Het
Muc16 A C 9: 18,642,742 V4085G unknown Het
Mvp T C 7: 126,992,650 Q456R probably benign Het
Myf6 T C 10: 107,493,457 D209G probably benign Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr1032 T G 2: 86,007,981 D68E probably damaging Het
Olfr323 A G 11: 58,625,236 L270P probably benign Het
Olfr365 A G 2: 37,201,280 D13G probably benign Het
Olfr560 T A 7: 102,753,527 Y134F probably damaging Het
Olfr786 T C 10: 129,436,989 F59S probably damaging Het
Phf20 A G 2: 156,272,617 D295G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1r13b A T 12: 111,844,982 H157Q probably benign Het
Rbm26 C T 14: 105,153,603 R149H unknown Het
Reg3d C T 6: 78,378,460 C16Y possibly damaging Het
Rrp36 A G 17: 46,668,054 F193L possibly damaging Het
Rtca A T 3: 116,489,256 M361K probably benign Het
Ryr3 T G 2: 112,661,636 D3790A probably damaging Het
Serpina3n C A 12: 104,411,181 A231E probably benign Het
Sh2d2a A G 3: 87,851,763 D224G possibly damaging Het
Sh3bp2 A T 5: 34,561,033 K526* probably null Het
Slc12a2 A G 18: 57,936,397 T1017A possibly damaging Het
Slc12a8 T C 16: 33,541,027 L93P probably damaging Het
Slc5a6 A G 5: 31,037,846 I469T probably damaging Het
Smarcc1 T A 9: 110,135,660 V95D probably damaging Het
Snap29 T A 16: 17,406,299 S59R probably damaging Het
Tmem121b T A 6: 120,492,823 Y311F probably damaging Het
Tpcn1 C A 5: 120,555,935 V199L probably benign Het
Ttn T C 2: 76,788,377 I16188V probably benign Het
Usp24 T C 4: 106,359,050 I366T possibly damaging Het
Utrn T A 10: 12,669,719 E1727D probably damaging Het
Vav2 T C 2: 27,292,689 D301G probably damaging Het
Vmn2r104 T C 17: 20,042,825 T125A probably benign Het
Vmn2r73 T G 7: 85,857,915 I730L probably benign Het
Zfp352 A T 4: 90,224,881 K419N probably benign Het
Zfp84 C A 7: 29,775,448 S48R probably damaging Het
Zfp947 A T 17: 22,145,405 H429Q probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9189:Flnb UTSW 14 7892976 missense possibly damaging 0.90
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9484:Flnb UTSW 14 7929004 missense probably benign 0.06
R9505:Flnb UTSW 14 7904665 missense probably benign
R9525:Flnb UTSW 14 7905481 missense probably damaging 1.00
R9621:Flnb UTSW 14 7926421 missense probably damaging 0.99
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGCAGCGCTTTCTAACCCTC -3'
(R):5'- CCAATGGACACGAGCTTAATG -3'

Sequencing Primer
(F):5'- AACCCTCTCCCCACTTGC -3'
(R):5'- TCGTGGTCTAGGAACTCCAGAG -3'
Posted On 2022-02-07