Incidental Mutation 'R9180:Fer1l6'
ID 696989
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9180 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58494230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1141 (V1141A)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably benign
Transcript: ENSMUST00000161028
AA Change: V1141A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: V1141A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 137,889,470 (GRCm39) P49L probably benign Het
Adam34l T A 8: 44,079,970 (GRCm39) R85* probably null Het
Anapc2 C T 2: 25,163,303 (GRCm39) T180I probably benign Het
Ankib1 A T 5: 3,756,276 (GRCm39) H556Q probably damaging Het
Aox1 A T 1: 58,378,777 (GRCm39) K1009* probably null Het
Apob C T 12: 8,047,925 (GRCm39) P968L probably damaging Het
Bpi T A 2: 158,116,608 (GRCm39) F335Y probably benign Het
Cabcoco1 T C 10: 68,272,719 (GRCm39) Y222C probably damaging Het
Camk2b G T 11: 5,939,332 (GRCm39) C273* probably null Het
Catsperd G A 17: 56,968,252 (GRCm39) D546N probably benign Het
Cenpb C T 2: 131,021,463 (GRCm39) G112S probably damaging Het
Col6a5 A G 9: 105,739,178 (GRCm39) L2585P probably damaging Het
Cop1 A G 1: 159,147,339 (GRCm39) E555G probably damaging Het
Coro1b T C 19: 4,203,392 (GRCm39) V411A probably benign Het
Cyfip2 G A 11: 46,176,920 (GRCm39) R87C probably damaging Het
Dthd1 A C 5: 63,045,410 (GRCm39) I725L probably benign Het
Dydc1 A C 14: 40,800,054 (GRCm39) E20A probably damaging Het
Ermp1 T C 19: 29,609,845 (GRCm39) I317V probably benign Het
Fat4 A G 3: 38,942,556 (GRCm39) N483S possibly damaging Het
Fbxo33 A G 12: 59,251,095 (GRCm39) probably null Het
Fcgbp G T 7: 27,803,198 (GRCm39) E1601* probably null Het
Fer1l5 A T 1: 36,449,999 (GRCm39) S1118C probably null Het
Flnb C T 14: 7,818,219 (GRCm38) T23M probably damaging Het
Fsip2 T C 2: 82,815,574 (GRCm39) L3769P possibly damaging Het
Gna11 T C 10: 81,370,942 (GRCm39) K98R Het
Gpat3 A T 5: 101,032,230 (GRCm39) T176S probably benign Het
Gprc5b A G 7: 118,583,542 (GRCm39) L109P probably damaging Het
Hadha A T 5: 30,340,038 (GRCm39) N246K probably benign Het
Haus3 G A 5: 34,324,835 (GRCm39) Q275* probably null Het
Higd1b A G 11: 102,728,090 (GRCm39) Y44C possibly damaging Het
Igkv1-131 T C 6: 67,743,218 (GRCm39) K55R probably benign Het
Igtp G T 11: 58,098,091 (GRCm39) E421* probably null Het
Kcnk3 G T 5: 30,745,532 (GRCm39) probably benign Het
Krtap4-13 A T 11: 99,700,165 (GRCm39) C165S unknown Het
Lrfn4 T C 19: 4,663,353 (GRCm39) R394G probably benign Het
Lrrc7 A C 3: 157,867,011 (GRCm39) L910R possibly damaging Het
Mbtd1 A G 11: 93,823,218 (GRCm39) D568G probably damaging Het
Mettl16 T A 11: 74,693,826 (GRCm39) I279N probably benign Het
Mmrn2 A G 14: 34,121,158 (GRCm39) H676R probably benign Het
Mrgprg T C 7: 143,318,350 (GRCm39) K254R probably benign Het
Muc16 A C 9: 18,554,038 (GRCm39) V4085G unknown Het
Mvp T C 7: 126,591,822 (GRCm39) Q456R probably benign Het
Myf6 T C 10: 107,329,318 (GRCm39) D209G probably benign Het
Ociad1 A G 5: 73,467,725 (GRCm39) D167G probably benign Het
Or11l3 A G 11: 58,516,062 (GRCm39) L270P probably benign Het
Or1l4 A G 2: 37,091,292 (GRCm39) D13G probably benign Het
Or51f23b T A 7: 102,402,734 (GRCm39) Y134F probably damaging Het
Or5m3 T G 2: 85,838,325 (GRCm39) D68E probably damaging Het
Or6c1b T C 10: 129,272,858 (GRCm39) F59S probably damaging Het
Phf20 A G 2: 156,114,537 (GRCm39) D295G probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Ppp1r13b A T 12: 111,811,416 (GRCm39) H157Q probably benign Het
Prss3b A G 6: 41,008,681 (GRCm39) L211P probably damaging Het
Rbm26 C T 14: 105,391,039 (GRCm39) R149H unknown Het
Reg3d C T 6: 78,355,443 (GRCm39) C16Y possibly damaging Het
Rrp36 A G 17: 46,978,980 (GRCm39) F193L possibly damaging Het
Rtca A T 3: 116,282,905 (GRCm39) M361K probably benign Het
Ryr3 T G 2: 112,491,981 (GRCm39) D3790A probably damaging Het
Serpina3n C A 12: 104,377,440 (GRCm39) A231E probably benign Het
Sh2d2a A G 3: 87,759,070 (GRCm39) D224G possibly damaging Het
Sh3bp2 A T 5: 34,718,377 (GRCm39) K526* probably null Het
Slc12a2 A G 18: 58,069,469 (GRCm39) T1017A possibly damaging Het
Slc12a8 T C 16: 33,361,397 (GRCm39) L93P probably damaging Het
Slc5a6 A G 5: 31,195,190 (GRCm39) I469T probably damaging Het
Smarcc1 T A 9: 109,964,728 (GRCm39) V95D probably damaging Het
Snap29 T A 16: 17,224,163 (GRCm39) S59R probably damaging Het
Tmem121b T A 6: 120,469,784 (GRCm39) Y311F probably damaging Het
Tpcn1 C A 5: 120,694,000 (GRCm39) V199L probably benign Het
Ttn T C 2: 76,618,721 (GRCm39) I16188V probably benign Het
Usp24 T C 4: 106,216,247 (GRCm39) I366T possibly damaging Het
Utrn T A 10: 12,545,463 (GRCm39) E1727D probably damaging Het
Vav2 T C 2: 27,182,701 (GRCm39) D301G probably damaging Het
Vmn2r104 T C 17: 20,263,087 (GRCm39) T125A probably benign Het
Vmn2r73 T G 7: 85,507,123 (GRCm39) I730L probably benign Het
Zfp352 A T 4: 90,113,118 (GRCm39) K419N probably benign Het
Zfp84 C A 7: 29,474,873 (GRCm39) S48R probably damaging Het
Zfp947 A T 17: 22,364,386 (GRCm39) H429Q probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58,435,899 (GRCm39) missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTATCTCCCTAGGAAAATGGGTAG -3'
(R):5'- ACTGACCGGGTAAATAAGACC -3'

Sequencing Primer
(F):5'- CTCCCTAGGAAAATGGGTAGTTTTTC -3'
(R):5'- GGTAAATAAGACCCAGGATTACCC -3'
Posted On 2022-02-07