Incidental Mutation 'R9181:Abcg3'
ID 697019
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 105121962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 138 (D138E)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: D138E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: D138E

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
AA Change: D138E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: D138E

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGGAAACAGCTTGTGGAG -3'
(R):5'- GGGAACATTTGGATCAGGCTC -3'

Sequencing Primer
(F):5'- AGGGGCATGTCATCCACAC -3'
(R):5'- AACATTTGGATCAGGCTCTGTGTTTG -3'
Posted On 2022-02-07