Incidental Mutation 'R9181:Ssc5d'
ID 697023
Institutional Source Beutler Lab
Gene Symbol Ssc5d
Ensembl Gene ENSMUSG00000035279
Gene Name scavenger receptor cysteine rich family, 5 domains
Synonyms A430110N23Rik, s5d-srcrb
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 4928820-4947827 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4945814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 949 (T949A)
Ref Sequence ENSEMBL: ENSMUSP00000052126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]
AlphaFold Q8BV57
Predicted Effect possibly damaging
Transcript: ENSMUST00000057612
AA Change: T949A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: T949A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SR 20 120 4.44e-49 SMART
low complexity region 141 155 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
SR 199 299 2.36e-53 SMART
SR 305 405 8.22e-53 SMART
low complexity region 437 462 N/A INTRINSIC
SR 464 565 1.11e-49 SMART
low complexity region 741 755 N/A INTRINSIC
SR 758 858 3.93e-50 SMART
low complexity region 936 957 N/A INTRINSIC
low complexity region 981 1004 N/A INTRINSIC
low complexity region 1018 1035 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1357 1364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Ssc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ssc5d APN 7 4,947,480 (GRCm39) missense possibly damaging 0.63
IGL00939:Ssc5d APN 7 4,939,280 (GRCm39) missense possibly damaging 0.89
IGL01109:Ssc5d APN 7 4,940,111 (GRCm39) nonsense probably null
IGL01409:Ssc5d APN 7 4,945,808 (GRCm39) missense probably benign 0.16
IGL01880:Ssc5d APN 7 4,936,218 (GRCm39) missense probably damaging 1.00
IGL02013:Ssc5d APN 7 4,946,835 (GRCm39) missense probably benign 0.00
IGL02227:Ssc5d APN 7 4,936,453 (GRCm39) critical splice donor site probably null
IGL02963:Ssc5d APN 7 4,947,326 (GRCm39) missense probably benign 0.02
D4043:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
D4216:Ssc5d UTSW 7 4,946,982 (GRCm39) missense possibly damaging 0.70
R0104:Ssc5d UTSW 7 4,939,285 (GRCm39) missense probably benign 0.41
R0115:Ssc5d UTSW 7 4,930,880 (GRCm39) unclassified probably benign
R0201:Ssc5d UTSW 7 4,947,662 (GRCm39) missense probably benign
R0365:Ssc5d UTSW 7 4,931,466 (GRCm39) nonsense probably null
R0485:Ssc5d UTSW 7 4,940,470 (GRCm39) missense probably damaging 0.99
R0967:Ssc5d UTSW 7 4,947,342 (GRCm39) nonsense probably null
R1607:Ssc5d UTSW 7 4,947,042 (GRCm39) missense probably benign 0.25
R1639:Ssc5d UTSW 7 4,931,416 (GRCm39) missense probably damaging 1.00
R1801:Ssc5d UTSW 7 4,939,606 (GRCm39) missense probably benign 0.05
R1867:Ssc5d UTSW 7 4,931,506 (GRCm39) missense probably damaging 1.00
R1999:Ssc5d UTSW 7 4,945,713 (GRCm39) missense possibly damaging 0.86
R2007:Ssc5d UTSW 7 4,931,628 (GRCm39) missense probably damaging 1.00
R2084:Ssc5d UTSW 7 4,940,011 (GRCm39) missense probably benign 0.01
R2234:Ssc5d UTSW 7 4,946,849 (GRCm39) missense probably benign
R2259:Ssc5d UTSW 7 4,946,915 (GRCm39) missense probably benign 0.01
R2567:Ssc5d UTSW 7 4,939,334 (GRCm39) missense probably damaging 1.00
R2879:Ssc5d UTSW 7 4,939,906 (GRCm39) critical splice acceptor site probably null
R3782:Ssc5d UTSW 7 4,945,790 (GRCm39) missense probably benign 0.00
R3875:Ssc5d UTSW 7 4,930,261 (GRCm39) missense probably damaging 1.00
R4322:Ssc5d UTSW 7 4,931,449 (GRCm39) missense probably damaging 1.00
R4331:Ssc5d UTSW 7 4,945,725 (GRCm39) missense probably benign 0.00
R4334:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4430:Ssc5d UTSW 7 4,946,663 (GRCm39) missense probably benign
R4619:Ssc5d UTSW 7 4,932,524 (GRCm39) missense probably damaging 1.00
R4794:Ssc5d UTSW 7 4,946,744 (GRCm39) missense probably benign
R5106:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R5174:Ssc5d UTSW 7 4,930,970 (GRCm39) missense possibly damaging 0.83
R5553:Ssc5d UTSW 7 4,939,289 (GRCm39) missense probably damaging 1.00
R5649:Ssc5d UTSW 7 4,929,517 (GRCm39) critical splice donor site probably null
R5786:Ssc5d UTSW 7 4,939,817 (GRCm39) missense probably benign 0.00
R6059:Ssc5d UTSW 7 4,945,743 (GRCm39) missense possibly damaging 0.86
R6163:Ssc5d UTSW 7 4,930,253 (GRCm39) missense probably damaging 1.00
R6332:Ssc5d UTSW 7 4,940,521 (GRCm39) missense probably damaging 1.00
R6341:Ssc5d UTSW 7 4,939,664 (GRCm39) missense probably benign 0.31
R6613:Ssc5d UTSW 7 4,936,292 (GRCm39) missense possibly damaging 0.82
R7180:Ssc5d UTSW 7 4,939,600 (GRCm39) missense probably benign 0.17
R7576:Ssc5d UTSW 7 4,931,572 (GRCm39) missense probably damaging 1.00
R7602:Ssc5d UTSW 7 4,945,745 (GRCm39) missense possibly damaging 0.95
R7609:Ssc5d UTSW 7 4,930,575 (GRCm39) missense possibly damaging 0.56
R7691:Ssc5d UTSW 7 4,947,168 (GRCm39) missense probably benign 0.29
R7759:Ssc5d UTSW 7 4,940,529 (GRCm39) nonsense probably null
R8480:Ssc5d UTSW 7 4,939,328 (GRCm39) missense probably damaging 1.00
R9029:Ssc5d UTSW 7 4,930,919 (GRCm39) missense probably damaging 0.97
R9163:Ssc5d UTSW 7 4,936,432 (GRCm39) missense probably damaging 1.00
R9178:Ssc5d UTSW 7 4,930,058 (GRCm39) missense probably damaging 1.00
R9382:Ssc5d UTSW 7 4,930,283 (GRCm39) critical splice donor site probably null
R9489:Ssc5d UTSW 7 4,940,599 (GRCm39) missense probably benign 0.02
R9626:Ssc5d UTSW 7 4,946,568 (GRCm39) missense probably benign
R9630:Ssc5d UTSW 7 4,939,426 (GRCm39) missense probably damaging 1.00
R9776:Ssc5d UTSW 7 4,932,367 (GRCm39) missense probably benign 0.07
X0063:Ssc5d UTSW 7 4,939,286 (GRCm39) missense probably damaging 1.00
Z1088:Ssc5d UTSW 7 4,931,433 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGGTAATGAGCAGCAGG -3'
(R):5'- TGGGATACGAGAAGACTCCTAG -3'

Sequencing Primer
(F):5'- GAAAAAGTGGAAGGAGGACTCAACTC -3'
(R):5'- CAGCCTTTTAGAGTCAGAGGC -3'
Posted On 2022-02-07