Incidental Mutation 'R9181:Nlrp4e'
ID 697026
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9181 (G1)
Quality Score 171.009
Status Not validated
Chromosome 7
Chromosomal Location 23301192-23362277 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 23361845 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 954 (R954*)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect probably null
Transcript: ENSMUST00000076470
AA Change: R954*
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: R954*

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 104,974,096 D138E probably benign Het
Acvr2a T A 2: 48,870,295 I21K probably damaging Het
Adam30 C G 3: 98,162,878 P676A probably benign Het
AF529169 A G 9: 89,603,341 M1T probably null Het
Ankrd28 A C 14: 31,748,670 H145Q probably damaging Het
Ap3m2 A G 8: 22,799,758 Y110H probably damaging Het
Apoc4 A G 7: 19,678,740 S27P possibly damaging Het
Bbs1 A C 19: 4,891,042 L548R possibly damaging Het
Cfap99 A T 5: 34,314,258 D346V probably damaging Het
Col13a1 T C 10: 61,867,833 K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Dbf4 A G 5: 8,412,206 V105A possibly damaging Het
Disp2 T A 2: 118,786,912 V129E probably benign Het
Dnah7b T C 1: 46,142,034 V1027A probably damaging Het
Dst T A 1: 34,192,737 I3137N probably benign Het
F5 A G 1: 164,192,326 D790G probably benign Het
Fan1 A G 7: 64,366,652 S575P probably damaging Het
Gemin5 C T 11: 58,130,209 A1051T probably benign Het
Gm10424 A T 5: 95,270,555 V194D probably benign Het
Gsta4 A G 9: 78,198,315 Y9C probably damaging Het
H2-M3 C A 17: 37,272,281 A211E probably damaging Het
Ifna1 A T 4: 88,850,216 M44L probably benign Het
Ildr2 A T 1: 166,294,714 D242V probably damaging Het
Kif27 G T 13: 58,344,729 Q199K probably damaging Het
Lmf1 T A 17: 25,585,744 L132H probably damaging Het
Mbtd1 A G 11: 93,912,415 N173S probably benign Het
Mgat4c A T 10: 102,389,262 N446Y probably benign Het
Mocs1 T A 17: 49,449,773 M261K probably damaging Het
Nlrp10 A T 7: 108,924,901 F457L probably damaging Het
Olfr1191-ps1 T C 2: 88,643,004 M79T probably benign Het
Pigu T C 2: 155,299,189 I261M probably damaging Het
Pkd1l3 T A 8: 109,648,686 I1576N probably damaging Het
Plekhg6 A C 6: 125,378,891 probably benign Het
Pmpca T C 2: 26,393,353 L388P probably damaging Het
Polg A T 7: 79,454,673 I818N probably damaging Het
Radil A G 5: 142,494,967 Y578H probably damaging Het
Retnlb A G 16: 48,818,721 D95G probably damaging Het
Rrnad1 A G 3: 87,928,085 probably benign Het
Rufy2 A T 10: 63,000,387 Y365F possibly damaging Het
Ssc5d A G 7: 4,942,815 T949A possibly damaging Het
Svil C A 18: 5,090,833 R1312S possibly damaging Het
Syne1 T C 10: 5,113,994 T7142A probably damaging Het
Tpbgl A T 7: 99,625,569 D360E probably damaging Het
Traj13 G A 14: 54,205,791 V17I unknown Het
Trim13 G A 14: 61,604,597 R21Q possibly damaging Het
Wdr36 T C 18: 32,848,329 V357A possibly damaging Het
Xdh G A 17: 73,925,011 R235C probably damaging Het
Zfp971 T C 2: 178,032,943 F112L probably damaging Het
Znfx1 C T 2: 167,037,818 C1546Y probably damaging Het
Znfx1 T A 2: 167,038,217 E1413V probably benign Het
Zscan4c A G 7: 11,009,814 M447V probably benign Het
Zyx T A 6: 42,357,884 D541E probably damaging Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23321131 missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23320978 missense probably benign
R9167:Nlrp4e UTSW 7 23340526 missense probably benign 0.00
R9219:Nlrp4e UTSW 7 23321516 missense possibly damaging 0.50
R9229:Nlrp4e UTSW 7 23321374 missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23321330 missense probably benign
R9323:Nlrp4e UTSW 7 23321330 missense probably benign
R9325:Nlrp4e UTSW 7 23321330 missense probably benign
R9379:Nlrp4e UTSW 7 23321330 missense probably benign
R9380:Nlrp4e UTSW 7 23321330 missense probably benign
R9448:Nlrp4e UTSW 7 23301531 missense probably benign
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTACCTGAACTTGGCCTTGG -3'
(R):5'- CCTTTGGAGGTAGTTCGACG -3'

Sequencing Primer
(F):5'- GAGAAATGGCTCCTCTGTTAAGC -3'
(R):5'- CGTAGTTTGAGGTCAGAATACAGCC -3'
Posted On 2022-02-07