Incidental Mutation 'R9181:Fan1'
ID 697027
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene Name FANCD2/FANCI-associated nuclease 1
Synonyms Mtmr15, 6030441H18Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 63996506-64023843 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64016400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 575 (S575P)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163289]
AlphaFold Q69ZT1
Predicted Effect probably damaging
Transcript: ENSMUST00000163289
AA Change: S575P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: S575P

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64,022,297 (GRCm39) missense probably damaging 0.96
IGL01752:Fan1 APN 7 64,022,542 (GRCm39) missense probably benign 0.00
IGL01971:Fan1 APN 7 64,003,459 (GRCm39) missense probably damaging 0.98
IGL02043:Fan1 APN 7 64,021,367 (GRCm39) splice site probably null
IGL02542:Fan1 APN 7 64,014,408 (GRCm39) missense probably damaging 1.00
IGL02731:Fan1 APN 7 64,022,741 (GRCm39) missense possibly damaging 0.86
IGL03111:Fan1 APN 7 63,999,816 (GRCm39) missense possibly damaging 0.67
hitched UTSW 7 64,014,377 (GRCm39) missense probably damaging 1.00
stitched UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R0270:Fan1 UTSW 7 63,998,619 (GRCm39) missense probably benign 0.26
R0632:Fan1 UTSW 7 64,012,947 (GRCm39) missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64,016,435 (GRCm39) missense probably benign 0.29
R1750:Fan1 UTSW 7 64,022,761 (GRCm39) missense probably benign 0.14
R1822:Fan1 UTSW 7 64,022,554 (GRCm39) missense probably benign 0.00
R2031:Fan1 UTSW 7 64,004,172 (GRCm39) missense probably damaging 0.98
R2107:Fan1 UTSW 7 64,016,536 (GRCm39) missense probably damaging 1.00
R2126:Fan1 UTSW 7 63,996,636 (GRCm39) missense probably damaging 1.00
R2869:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2869:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2870:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2870:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2871:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2871:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R2873:Fan1 UTSW 7 64,012,938 (GRCm39) missense probably benign 0.16
R3849:Fan1 UTSW 7 64,022,119 (GRCm39) missense probably damaging 1.00
R3850:Fan1 UTSW 7 64,022,119 (GRCm39) missense probably damaging 1.00
R3949:Fan1 UTSW 7 64,021,292 (GRCm39) nonsense probably null
R4007:Fan1 UTSW 7 64,016,309 (GRCm39) missense probably damaging 1.00
R4490:Fan1 UTSW 7 64,018,928 (GRCm39) missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64,023,301 (GRCm39) nonsense probably null
R4918:Fan1 UTSW 7 64,023,286 (GRCm39) utr 5 prime probably benign
R5328:Fan1 UTSW 7 64,004,217 (GRCm39) missense probably damaging 1.00
R5691:Fan1 UTSW 7 64,004,118 (GRCm39) splice site probably null
R5902:Fan1 UTSW 7 64,023,070 (GRCm39) splice site probably null
R5905:Fan1 UTSW 7 64,003,399 (GRCm39) missense probably benign 0.00
R6126:Fan1 UTSW 7 64,014,318 (GRCm39) nonsense probably null
R6195:Fan1 UTSW 7 64,004,119 (GRCm39) missense probably damaging 1.00
R6233:Fan1 UTSW 7 64,004,119 (GRCm39) missense probably damaging 1.00
R6405:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6434:Fan1 UTSW 7 64,004,129 (GRCm39) missense probably damaging 0.99
R6460:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6469:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6471:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6473:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6696:Fan1 UTSW 7 63,999,826 (GRCm39) missense probably damaging 1.00
R6708:Fan1 UTSW 7 64,022,554 (GRCm39) missense probably benign 0.00
R6713:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6714:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6749:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6841:Fan1 UTSW 7 64,014,377 (GRCm39) missense probably damaging 1.00
R6858:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6859:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6860:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6925:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6927:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6936:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6938:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R6939:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7040:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7120:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7290:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7292:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7459:Fan1 UTSW 7 63,998,714 (GRCm39) missense probably damaging 0.99
R7460:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7464:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7465:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7465:Fan1 UTSW 7 64,003,386 (GRCm39) missense probably benign 0.30
R7608:Fan1 UTSW 7 64,003,979 (GRCm39) splice site probably null
R7624:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7629:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R7682:Fan1 UTSW 7 64,022,512 (GRCm39) missense probably benign 0.06
R7731:Fan1 UTSW 7 64,022,444 (GRCm39) missense probably benign 0.17
R7863:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8054:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8055:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8057:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8058:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8101:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8241:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8262:Fan1 UTSW 7 64,023,054 (GRCm39) missense probably benign 0.02
R8274:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8275:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8276:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8285:Fan1 UTSW 7 64,016,348 (GRCm39) missense probably damaging 0.96
R8318:Fan1 UTSW 7 63,999,803 (GRCm39) missense probably damaging 1.00
R8402:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8466:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8468:Fan1 UTSW 7 64,022,234 (GRCm39) missense probably damaging 0.97
R8799:Fan1 UTSW 7 64,016,406 (GRCm39) missense probably damaging 0.99
R8821:Fan1 UTSW 7 64,004,249 (GRCm39) missense probably damaging 1.00
R9030:Fan1 UTSW 7 64,022,761 (GRCm39) missense probably benign 0.14
R9525:Fan1 UTSW 7 64,022,007 (GRCm39) critical splice donor site probably null
R9564:Fan1 UTSW 7 63,999,240 (GRCm39) missense possibly damaging 0.65
R9565:Fan1 UTSW 7 63,999,240 (GRCm39) missense possibly damaging 0.65
R9796:Fan1 UTSW 7 64,022,278 (GRCm39) missense probably benign 0.09
X0025:Fan1 UTSW 7 64,022,583 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGAGAGACTTAGCACGGG -3'
(R):5'- CTGCGTGTTTCCAACAATGACTG -3'

Sequencing Primer
(F):5'- ACTTAGCACGGGTATCACAG -3'
(R):5'- TCCAACAATGACTGACATTTCTC -3'
Posted On 2022-02-07