Incidental Mutation 'R9181:Polg'
ID 697028
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Name polymerase (DNA directed), gamma
Synonyms Polga, Pol gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79095979-79116110 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79104421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 818 (I818N)
Ref Sequence ENSEMBL: ENSMUSP00000073551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000132091] [ENSMUST00000139290] [ENSMUST00000149444] [ENSMUST00000201907]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036865
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073889
AA Change: I818N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: I818N

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139668
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000143672
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201030
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect probably benign
Transcript: ENSMUST00000201907
SMART Domains Protein: ENSMUSP00000144084
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
Blast:POLAc 1 49 4e-24 BLAST
PDB:3IKM|D 1 50 6e-24 PDB
SCOP:d1t7pa2 21 49 3e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79,101,673 (GRCm39) missense probably damaging 1.00
IGL00970:Polg APN 7 79,101,493 (GRCm39) missense probably benign 0.01
IGL01883:Polg APN 7 79,108,066 (GRCm39) missense probably damaging 1.00
IGL02124:Polg APN 7 79,109,485 (GRCm39) missense probably damaging 1.00
IGL02127:Polg APN 7 79,107,915 (GRCm39) unclassified probably benign
IGL02820:Polg APN 7 79,109,519 (GRCm39) missense possibly damaging 0.92
IGL03075:Polg APN 7 79,101,660 (GRCm39) missense probably damaging 1.00
IGL03180:Polg APN 7 79,101,601 (GRCm39) splice site probably benign
IGL03198:Polg APN 7 79,101,470 (GRCm39) missense probably damaging 1.00
IGL03222:Polg APN 7 79,104,404 (GRCm39) missense probably damaging 0.98
R0030:Polg UTSW 7 79,101,876 (GRCm39) missense probably damaging 1.00
R0064:Polg UTSW 7 79,111,632 (GRCm39) missense probably damaging 1.00
R0064:Polg UTSW 7 79,111,632 (GRCm39) missense probably damaging 1.00
R0416:Polg UTSW 7 79,101,988 (GRCm39) unclassified probably benign
R0522:Polg UTSW 7 79,109,899 (GRCm39) splice site probably benign
R0638:Polg UTSW 7 79,109,896 (GRCm39) splice site probably benign
R1263:Polg UTSW 7 79,109,534 (GRCm39) missense probably benign
R1831:Polg UTSW 7 79,109,518 (GRCm39) missense probably benign 0.41
R1873:Polg UTSW 7 79,106,241 (GRCm39) missense probably benign 0.04
R1906:Polg UTSW 7 79,110,070 (GRCm39) missense probably damaging 1.00
R1997:Polg UTSW 7 79,108,979 (GRCm39) missense probably damaging 1.00
R2127:Polg UTSW 7 79,114,676 (GRCm39) missense probably damaging 1.00
R2155:Polg UTSW 7 79,111,468 (GRCm39) missense possibly damaging 0.94
R2156:Polg UTSW 7 79,111,468 (GRCm39) missense possibly damaging 0.94
R2173:Polg UTSW 7 79,105,341 (GRCm39) missense probably damaging 0.99
R3720:Polg UTSW 7 79,106,539 (GRCm39) nonsense probably null
R4082:Polg UTSW 7 79,114,576 (GRCm39) missense probably damaging 1.00
R4127:Polg UTSW 7 79,105,285 (GRCm39) missense probably damaging 1.00
R4510:Polg UTSW 7 79,105,270 (GRCm39) missense probably benign 0.01
R4511:Polg UTSW 7 79,105,270 (GRCm39) missense probably benign 0.01
R4571:Polg UTSW 7 79,110,127 (GRCm39) missense probably damaging 1.00
R4888:Polg UTSW 7 79,114,353 (GRCm39) missense probably damaging 1.00
R5008:Polg UTSW 7 79,109,822 (GRCm39) missense probably damaging 1.00
R5095:Polg UTSW 7 79,110,048 (GRCm39) missense possibly damaging 0.92
R5121:Polg UTSW 7 79,114,353 (GRCm39) missense probably damaging 1.00
R5139:Polg UTSW 7 79,099,773 (GRCm39) missense probably damaging 1.00
R5213:Polg UTSW 7 79,103,846 (GRCm39) missense probably damaging 1.00
R5285:Polg UTSW 7 79,114,973 (GRCm39) utr 5 prime probably benign
R5498:Polg UTSW 7 79,104,418 (GRCm39) missense probably damaging 1.00
R5714:Polg UTSW 7 79,101,739 (GRCm39) missense possibly damaging 0.53
R5940:Polg UTSW 7 79,103,819 (GRCm39) missense possibly damaging 0.95
R6146:Polg UTSW 7 79,100,260 (GRCm39) missense probably benign 0.02
R6754:Polg UTSW 7 79,109,584 (GRCm39) missense probably damaging 1.00
R6791:Polg UTSW 7 79,109,857 (GRCm39) missense probably benign 0.25
R6829:Polg UTSW 7 79,109,857 (GRCm39) missense probably benign 0.25
R6913:Polg UTSW 7 79,110,405 (GRCm39) missense probably damaging 0.97
R7644:Polg UTSW 7 79,101,416 (GRCm39) missense probably damaging 1.00
R7879:Polg UTSW 7 79,100,392 (GRCm39) missense probably benign 0.22
R8174:Polg UTSW 7 79,106,466 (GRCm39) missense probably benign 0.10
R8443:Polg UTSW 7 79,114,743 (GRCm39) missense probably benign
R9176:Polg UTSW 7 79,109,857 (GRCm39) missense probably benign 0.25
R9303:Polg UTSW 7 79,105,860 (GRCm39) missense probably benign 0.02
R9305:Polg UTSW 7 79,105,860 (GRCm39) missense probably benign 0.02
R9323:Polg UTSW 7 79,114,786 (GRCm39) frame shift probably null
R9323:Polg UTSW 7 79,114,779 (GRCm39) frame shift probably null
R9331:Polg UTSW 7 79,108,148 (GRCm39) missense probably damaging 1.00
Z1176:Polg UTSW 7 79,103,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTGAGCCCTCTGTAGCC -3'
(R):5'- TTCCCAGATGGTGGTATGGC -3'

Sequencing Primer
(F):5'- TCTGTAGCCCAGAGAACTTTC -3'
(R):5'- AGATGGTGGTATGGCTCCCC -3'
Posted On 2022-02-07