Incidental Mutation 'R9181:Nlrp10'
ID 697030
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene Name NLR family, pyrin domain containing 10
Synonyms Nalp10, 6430548I20Rik, Pynod
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 108521060-108529365 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108524108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 457 (F457L)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
AlphaFold Q8CCN1
PDB Structure Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000055745
AA Change: F457L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: F457L

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108,523,788 (GRCm39) missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108,526,159 (GRCm39) missense probably benign
IGL02043:Nlrp10 APN 7 108,524,709 (GRCm39) missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108,524,118 (GRCm39) missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108,523,869 (GRCm39) missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108,524,529 (GRCm39) missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108,524,529 (GRCm39) missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108,523,492 (GRCm39) missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108,523,492 (GRCm39) missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108,524,217 (GRCm39) missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108,525,088 (GRCm39) missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108,524,595 (GRCm39) missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108,523,555 (GRCm39) missense probably benign
R1567:Nlrp10 UTSW 7 108,526,257 (GRCm39) missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108,523,737 (GRCm39) missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108,526,248 (GRCm39) missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108,524,602 (GRCm39) nonsense probably null
R1952:Nlrp10 UTSW 7 108,523,770 (GRCm39) missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108,524,325 (GRCm39) missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108,524,835 (GRCm39) missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108,523,683 (GRCm39) missense probably benign
R3616:Nlrp10 UTSW 7 108,523,683 (GRCm39) missense probably benign
R4207:Nlrp10 UTSW 7 108,523,548 (GRCm39) missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108,524,445 (GRCm39) missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108,523,772 (GRCm39) missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108,523,468 (GRCm39) missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108,526,220 (GRCm39) missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108,523,784 (GRCm39) missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108,523,784 (GRCm39) missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108,523,671 (GRCm39) missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108,524,953 (GRCm39) missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108,526,107 (GRCm39) missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108,524,405 (GRCm39) missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108,523,855 (GRCm39) missense probably benign 0.02
R7397:Nlrp10 UTSW 7 108,523,899 (GRCm39) missense probably damaging 1.00
R7720:Nlrp10 UTSW 7 108,523,695 (GRCm39) missense probably benign 0.36
R7763:Nlrp10 UTSW 7 108,525,033 (GRCm39) missense probably damaging 0.99
R7776:Nlrp10 UTSW 7 108,524,656 (GRCm39) missense probably damaging 1.00
R7823:Nlrp10 UTSW 7 108,523,468 (GRCm39) missense probably benign 0.00
R7852:Nlrp10 UTSW 7 108,524,281 (GRCm39) missense probably damaging 1.00
R8272:Nlrp10 UTSW 7 108,525,103 (GRCm39) missense probably benign 0.00
R9712:Nlrp10 UTSW 7 108,524,735 (GRCm39) missense probably damaging 1.00
Z1177:Nlrp10 UTSW 7 108,525,058 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAAGGAGCGATTCTGAAGC -3'
(R):5'- CTTACCAGGCACAAGGTACTG -3'

Sequencing Primer
(F):5'- GCAGAACTTCAGCCCCAAG -3'
(R):5'- CAAGGTACTGAAGAGTCTGTGCTCC -3'
Posted On 2022-02-07