Incidental Mutation 'R9181:Pkd1l3'
ID 697032
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Name polycystic kidney disease 1 like 3
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 110340828-110399305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110375318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1576 (I1576N)
Ref Sequence ENSEMBL: ENSMUSP00000104865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
AlphaFold Q2EG98
Predicted Effect probably damaging
Transcript: ENSMUST00000057344
AA Change: I1566N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: I1566N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109242
AA Change: I1576N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: I1576N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212537
AA Change: I1566N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 110,356,869 (GRCm39) missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 110,365,338 (GRCm39) missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 110,388,873 (GRCm39) missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 110,350,403 (GRCm39) missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 110,350,153 (GRCm39) missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 110,394,157 (GRCm39) critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 110,361,934 (GRCm39) missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 110,375,134 (GRCm39) critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 110,356,798 (GRCm39) missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 110,357,908 (GRCm39) critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 110,361,933 (GRCm39) missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 110,387,438 (GRCm39) missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 110,358,010 (GRCm39) missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 110,362,012 (GRCm39) missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 110,392,217 (GRCm39) missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 110,395,924 (GRCm39) missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 110,365,296 (GRCm39) missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 110,357,977 (GRCm39) missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 110,387,434 (GRCm39) missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 110,365,310 (GRCm39) missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 110,357,708 (GRCm39) missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02358:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02369:Pkd1l3 APN 8 110,342,977 (GRCm39) missense unknown
IGL02481:Pkd1l3 APN 8 110,341,414 (GRCm39) missense unknown
IGL02505:Pkd1l3 APN 8 110,359,848 (GRCm39) missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 110,374,132 (GRCm39) missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 110,367,522 (GRCm39) nonsense probably null
IGL02715:Pkd1l3 APN 8 110,353,458 (GRCm39) missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 110,388,736 (GRCm39) splice site probably benign
IGL03059:Pkd1l3 APN 8 110,374,999 (GRCm39) missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 110,382,165 (GRCm39) nonsense probably null
IGL03206:Pkd1l3 APN 8 110,350,345 (GRCm39) missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 110,388,738 (GRCm39) splice site probably benign
BB006:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
PIT4453001:Pkd1l3 UTSW 8 110,387,433 (GRCm39) missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 110,391,131 (GRCm39) missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 110,355,265 (GRCm39) splice site probably benign
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0255:Pkd1l3 UTSW 8 110,365,386 (GRCm39) missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 110,373,131 (GRCm39) splice site probably null
R0311:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0311:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0441:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0465:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0466:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0488:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0515:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 110,348,340 (GRCm39) missense unknown
R1464:Pkd1l3 UTSW 8 110,363,059 (GRCm39) splice site probably benign
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 110,367,402 (GRCm39) missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1574:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1599:Pkd1l3 UTSW 8 110,363,016 (GRCm39) missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 110,350,450 (GRCm39) missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 110,359,237 (GRCm39) missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 110,375,038 (GRCm39) missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 110,350,831 (GRCm39) missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 110,374,205 (GRCm39) nonsense probably null
R2185:Pkd1l3 UTSW 8 110,359,827 (GRCm39) missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 110,347,156 (GRCm39) missense unknown
R2260:Pkd1l3 UTSW 8 110,350,268 (GRCm39) missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 110,355,341 (GRCm39) missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R2435:Pkd1l3 UTSW 8 110,377,334 (GRCm39) missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 110,350,447 (GRCm39) missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 110,350,622 (GRCm39) missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 110,394,268 (GRCm39) splice site probably benign
R3755:Pkd1l3 UTSW 8 110,359,171 (GRCm39) missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 110,362,949 (GRCm39) missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 110,373,511 (GRCm39) missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 110,350,751 (GRCm39) missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 110,359,345 (GRCm39) splice site probably null
R4893:Pkd1l3 UTSW 8 110,365,026 (GRCm39) missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 110,367,475 (GRCm39) missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 110,392,268 (GRCm39) missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 110,349,787 (GRCm39) missense unknown
R5207:Pkd1l3 UTSW 8 110,359,823 (GRCm39) missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 110,367,424 (GRCm39) missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 110,393,684 (GRCm39) missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 110,382,152 (GRCm39) missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 110,356,842 (GRCm39) missense probably benign
R5623:Pkd1l3 UTSW 8 110,350,351 (GRCm39) missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 110,353,468 (GRCm39) missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 110,349,811 (GRCm39) missense unknown
R6330:Pkd1l3 UTSW 8 110,373,541 (GRCm39) missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 110,358,016 (GRCm39) missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 110,350,595 (GRCm39) missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 110,349,844 (GRCm39) missense unknown
R6480:Pkd1l3 UTSW 8 110,365,019 (GRCm39) nonsense probably null
R6519:Pkd1l3 UTSW 8 110,355,404 (GRCm39) missense probably benign
R6654:Pkd1l3 UTSW 8 110,350,915 (GRCm39) missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 110,341,401 (GRCm39) missense unknown
R6733:Pkd1l3 UTSW 8 110,375,126 (GRCm39) splice site probably null
R6753:Pkd1l3 UTSW 8 110,351,081 (GRCm39) missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 110,353,446 (GRCm39) missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 110,341,246 (GRCm39) missense unknown
R6975:Pkd1l3 UTSW 8 110,387,539 (GRCm39) missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7018:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7083:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7139:Pkd1l3 UTSW 8 110,362,972 (GRCm39) missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7235:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7238:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7252:Pkd1l3 UTSW 8 110,387,330 (GRCm39) missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7309:Pkd1l3 UTSW 8 110,374,893 (GRCm39) splice site probably null
R7362:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7462:Pkd1l3 UTSW 8 110,355,409 (GRCm39) missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 110,365,008 (GRCm39) missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 110,359,947 (GRCm39) missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7516:Pkd1l3 UTSW 8 110,361,861 (GRCm39) missense probably damaging 1.00
R7553:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7559:Pkd1l3 UTSW 8 110,351,072 (GRCm39) missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 110,399,217 (GRCm39) missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 110,365,049 (GRCm39) missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 110,341,204 (GRCm39) missense unknown
R7749:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7751:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7755:Pkd1l3 UTSW 8 110,356,798 (GRCm39) missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7831:Pkd1l3 UTSW 8 110,357,990 (GRCm39) missense possibly damaging 0.47
R7835:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7849:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R7917:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7929:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7952:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8054:Pkd1l3 UTSW 8 110,373,008 (GRCm39) missense probably damaging 1.00
R8098:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8099:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8276:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R8352:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8376:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R8377:Pkd1l3 UTSW 8 110,361,982 (GRCm39) missense probably benign 0.08
R8398:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8399:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8400:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8412:Pkd1l3 UTSW 8 110,360,022 (GRCm39) missense possibly damaging 0.85
R8530:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8539:Pkd1l3 UTSW 8 110,362,919 (GRCm39) missense probably damaging 1.00
R8546:Pkd1l3 UTSW 8 110,393,615 (GRCm39) missense possibly damaging 0.52
R8558:Pkd1l3 UTSW 8 110,362,012 (GRCm39) missense probably damaging 1.00
R8719:Pkd1l3 UTSW 8 110,341,255 (GRCm39) missense unknown
R8769:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8797:Pkd1l3 UTSW 8 110,374,946 (GRCm39) missense probably benign 0.15
R8840:Pkd1l3 UTSW 8 110,349,842 (GRCm39) missense unknown
R8846:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8874:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8893:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8956:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8963:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8968:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R9035:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9054:Pkd1l3 UTSW 8 110,392,304 (GRCm39) missense probably benign 0.08
R9058:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9119:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9134:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9138:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9158:Pkd1l3 UTSW 8 110,394,207 (GRCm39) nonsense probably null
R9180:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9218:Pkd1l3 UTSW 8 110,382,128 (GRCm39) nonsense probably null
R9249:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9269:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9338:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9383:Pkd1l3 UTSW 8 110,350,601 (GRCm39) small deletion probably benign
R9396:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9423:Pkd1l3 UTSW 8 110,350,312 (GRCm39) missense possibly damaging 0.53
R9514:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9515:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9567:Pkd1l3 UTSW 8 110,394,173 (GRCm39) missense probably damaging 0.99
R9668:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9684:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9748:Pkd1l3 UTSW 8 110,373,555 (GRCm39) missense probably benign 0.00
R9778:Pkd1l3 UTSW 8 110,357,937 (GRCm39) missense probably benign 0.00
RF016:Pkd1l3 UTSW 8 110,350,174 (GRCm39) missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
X0026:Pkd1l3 UTSW 8 110,341,185 (GRCm39) missense probably null
Z1176:Pkd1l3 UTSW 8 110,349,874 (GRCm39) missense unknown
Z31818:Pkd1l3 UTSW 8 110,395,924 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATTCCACCAGTTTCCC -3'
(R):5'- GATAGCAAGTGCCCTAACCTG -3'

Sequencing Primer
(F):5'- CCATCCTCAGCCCAGGAGAAG -3'
(R):5'- TAATGATCGGTCCCATGC -3'
Posted On 2022-02-07