Incidental Mutation 'R9181:Kif27'
ID 697041
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Name kinesin family member 27
Synonyms 4930517I18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 58435316-58506936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 58492543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 199 (Q199K)
Ref Sequence ENSEMBL: ENSMUSP00000043304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
AlphaFold Q7M6Z4
Predicted Effect probably damaging
Transcript: ENSMUST00000043605
AA Change: Q199K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: Q199K

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably damaging
Transcript: ENSMUST00000225388
AA Change: Q199K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Retnlb A G 16: 48,639,084 (GRCm39) D95G probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58,485,418 (GRCm39) missense probably benign
IGL00421:Kif27 APN 13 58,491,703 (GRCm39) missense probably damaging 1.00
IGL00903:Kif27 APN 13 58,492,486 (GRCm39) missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58,436,015 (GRCm39) missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58,491,907 (GRCm39) missense probably damaging 1.00
IGL01761:Kif27 APN 13 58,485,459 (GRCm39) missense probably benign
IGL02160:Kif27 APN 13 58,473,812 (GRCm39) missense probably damaging 1.00
IGL03162:Kif27 APN 13 58,459,021 (GRCm39) missense probably benign 0.03
P0016:Kif27 UTSW 13 58,451,266 (GRCm39) nonsense probably null
R0016:Kif27 UTSW 13 58,502,528 (GRCm39) missense probably damaging 1.00
R0016:Kif27 UTSW 13 58,502,528 (GRCm39) missense probably damaging 1.00
R0018:Kif27 UTSW 13 58,435,867 (GRCm39) missense probably benign
R0018:Kif27 UTSW 13 58,435,867 (GRCm39) missense probably benign
R0049:Kif27 UTSW 13 58,451,378 (GRCm39) missense probably damaging 1.00
R0049:Kif27 UTSW 13 58,451,378 (GRCm39) missense probably damaging 1.00
R0481:Kif27 UTSW 13 58,459,078 (GRCm39) splice site probably benign
R0960:Kif27 UTSW 13 58,471,781 (GRCm39) missense probably damaging 0.99
R1015:Kif27 UTSW 13 58,468,029 (GRCm39) missense probably damaging 1.00
R1205:Kif27 UTSW 13 58,492,019 (GRCm39) missense probably benign 0.00
R1478:Kif27 UTSW 13 58,451,359 (GRCm39) missense probably damaging 0.98
R1789:Kif27 UTSW 13 58,491,822 (GRCm39) missense probably damaging 1.00
R1959:Kif27 UTSW 13 58,440,937 (GRCm39) missense probably benign 0.00
R1961:Kif27 UTSW 13 58,440,937 (GRCm39) missense probably benign 0.00
R3508:Kif27 UTSW 13 58,461,026 (GRCm39) missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58,493,562 (GRCm39) missense probably benign 0.01
R4247:Kif27 UTSW 13 58,435,731 (GRCm39) missense probably damaging 0.98
R4307:Kif27 UTSW 13 58,491,937 (GRCm39) missense probably benign 0.00
R4621:Kif27 UTSW 13 58,478,827 (GRCm39) missense probably benign 0.13
R4660:Kif27 UTSW 13 58,471,730 (GRCm39) missense probably damaging 0.99
R4661:Kif27 UTSW 13 58,471,730 (GRCm39) missense probably damaging 0.99
R4736:Kif27 UTSW 13 58,476,785 (GRCm39) missense probably benign 0.04
R4770:Kif27 UTSW 13 58,492,191 (GRCm39) missense probably damaging 1.00
R4853:Kif27 UTSW 13 58,459,072 (GRCm39) missense probably benign 0.06
R4963:Kif27 UTSW 13 58,476,808 (GRCm39) missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58,440,957 (GRCm39) missense probably damaging 0.98
R5134:Kif27 UTSW 13 58,438,904 (GRCm39) missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58,440,915 (GRCm39) missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58,460,960 (GRCm39) critical splice donor site probably null
R5875:Kif27 UTSW 13 58,458,918 (GRCm39) missense probably benign 0.01
R5929:Kif27 UTSW 13 58,491,784 (GRCm39) missense probably benign 0.01
R6175:Kif27 UTSW 13 58,459,051 (GRCm39) missense probably damaging 1.00
R6446:Kif27 UTSW 13 58,493,530 (GRCm39) missense probably damaging 1.00
R6628:Kif27 UTSW 13 58,502,611 (GRCm39) missense probably damaging 1.00
R7480:Kif27 UTSW 13 58,436,025 (GRCm39) missense probably benign 0.34
R8381:Kif27 UTSW 13 58,438,991 (GRCm39) missense probably benign 0.00
R8815:Kif27 UTSW 13 58,476,818 (GRCm39) missense probably damaging 0.97
R8993:Kif27 UTSW 13 58,473,912 (GRCm39) missense possibly damaging 0.93
R9486:Kif27 UTSW 13 58,492,348 (GRCm39) missense probably damaging 1.00
Z1088:Kif27 UTSW 13 58,435,847 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTTTCCTAGAGCAAGCAG -3'
(R):5'- GCAAAGGGTAACTGTTGTGG -3'

Sequencing Primer
(F):5'- GAATGGACTCTTTGAATCGTTCACC -3'
(R):5'- GCCAAGGAATGCCAAGTA -3'
Posted On 2022-02-07