Incidental Mutation 'R9181:Retnlb'
ID 697045
Institutional Source Beutler Lab
Gene Symbol Retnlb
Ensembl Gene ENSMUSG00000022650
Gene Name resistin like beta
Synonyms RELMbeta, Xcp3, 9030012B21Rik, Relmb, Fizz2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9181 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 48637219-48639255 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48639084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 95 (D95G)
Ref Sequence ENSEMBL: ENSMUSP00000023328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023328]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023328
AA Change: D95G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023328
Gene: ENSMUSG00000022650
AA Change: D95G

DomainStartEndE-ValueType
Pfam:Resistin 23 104 6.3e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene provides protection from DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 G T 5: 105,121,962 (GRCm39) D138E probably benign Het
Acvr2a T A 2: 48,760,307 (GRCm39) I21K probably damaging Het
Adam30 C G 3: 98,070,194 (GRCm39) P676A probably benign Het
Ankrd28 A C 14: 31,470,627 (GRCm39) H145Q probably damaging Het
Ap3m2 A G 8: 23,289,774 (GRCm39) Y110H probably damaging Het
Apoc4 A G 7: 19,412,665 (GRCm39) S27P possibly damaging Het
Bbs1 A C 19: 4,941,070 (GRCm39) L548R possibly damaging Het
Cfap99 A T 5: 34,471,602 (GRCm39) D346V probably damaging Het
Ckmt1 T A 2: 121,189,870 (GRCm39) probably benign Het
Col13a1 T C 10: 61,703,612 (GRCm39) K436E possibly damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Dbf4 A G 5: 8,462,206 (GRCm39) V105A possibly damaging Het
Disp2 T A 2: 118,617,393 (GRCm39) V129E probably benign Het
Dnah7b T C 1: 46,181,194 (GRCm39) V1027A probably damaging Het
Dst T A 1: 34,231,818 (GRCm39) I3137N probably benign Het
F5 A G 1: 164,019,895 (GRCm39) D790G probably benign Het
Fan1 A G 7: 64,016,400 (GRCm39) S575P probably damaging Het
Gemin5 C T 11: 58,021,035 (GRCm39) A1051T probably benign Het
Gsta4 A G 9: 78,105,597 (GRCm39) Y9C probably damaging Het
H2-M3 C A 17: 37,583,172 (GRCm39) A211E probably damaging Het
Ifna1 A T 4: 88,768,453 (GRCm39) M44L probably benign Het
Ildr2 A T 1: 166,122,283 (GRCm39) D242V probably damaging Het
Kif27 G T 13: 58,492,543 (GRCm39) Q199K probably damaging Het
Lmf1 T A 17: 25,804,718 (GRCm39) L132H probably damaging Het
Mbtd1 A G 11: 93,803,241 (GRCm39) N173S probably benign Het
Mettl25b A G 3: 87,835,392 (GRCm39) probably benign Het
Mgat4c A T 10: 102,225,123 (GRCm39) N446Y probably benign Het
Minar1 A G 9: 89,485,394 (GRCm39) M1T probably null Het
Mocs1 T A 17: 49,756,801 (GRCm39) M261K probably damaging Het
Nlrp10 A T 7: 108,524,108 (GRCm39) F457L probably damaging Het
Nlrp4e C T 7: 23,061,270 (GRCm39) R954* probably null Het
Or4s2 T C 2: 88,473,348 (GRCm39) M79T probably benign Het
Pigu T C 2: 155,141,109 (GRCm39) I261M probably damaging Het
Pkd1l3 T A 8: 110,375,318 (GRCm39) I1576N probably damaging Het
Plekhg6 A C 6: 125,355,854 (GRCm39) probably benign Het
Pmpca T C 2: 26,283,365 (GRCm39) L388P probably damaging Het
Polg A T 7: 79,104,421 (GRCm39) I818N probably damaging Het
Pramel46 A T 5: 95,418,414 (GRCm39) V194D probably benign Het
Radil A G 5: 142,480,722 (GRCm39) Y578H probably damaging Het
Rufy2 A T 10: 62,836,166 (GRCm39) Y365F possibly damaging Het
Ssc5d A G 7: 4,945,814 (GRCm39) T949A possibly damaging Het
Svil C A 18: 5,090,833 (GRCm39) R1312S possibly damaging Het
Syne1 T C 10: 5,063,994 (GRCm39) T7142A probably damaging Het
Tert A T 13: 73,785,294 (GRCm39) probably benign Het
Tpbgl A T 7: 99,274,776 (GRCm39) D360E probably damaging Het
Traj13 G A 14: 54,443,248 (GRCm39) V17I unknown Het
Trim13 G A 14: 61,842,046 (GRCm39) R21Q possibly damaging Het
Wdr36 T C 18: 32,981,382 (GRCm39) V357A possibly damaging Het
Xdh G A 17: 74,232,006 (GRCm39) R235C probably damaging Het
Zfp971 T C 2: 177,674,736 (GRCm39) F112L probably damaging Het
Znfx1 C T 2: 166,879,738 (GRCm39) C1546Y probably damaging Het
Znfx1 T A 2: 166,880,137 (GRCm39) E1413V probably benign Het
Zscan4c A G 7: 10,743,741 (GRCm39) M447V probably benign Het
Zyx T A 6: 42,334,818 (GRCm39) D541E probably damaging Het
Other mutations in Retnlb
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4418001:Retnlb UTSW 16 48,637,631 (GRCm39) missense probably benign 0.00
R0266:Retnlb UTSW 16 48,639,022 (GRCm39) nonsense probably null
R0790:Retnlb UTSW 16 48,637,589 (GRCm39) missense possibly damaging 0.51
R1473:Retnlb UTSW 16 48,639,028 (GRCm39) nonsense probably null
R1518:Retnlb UTSW 16 48,637,678 (GRCm39) missense probably benign 0.00
R3423:Retnlb UTSW 16 48,639,008 (GRCm39) missense probably damaging 1.00
R5661:Retnlb UTSW 16 48,638,429 (GRCm39) missense probably benign 0.19
R9097:Retnlb UTSW 16 48,638,980 (GRCm39) splice site probably benign
Predicted Primers PCR Primer
(F):5'- GCAAAGAGTCAAGGTGAATTTTCC -3'
(R):5'- ATGCAAAGGTACAGGTCTGC -3'

Sequencing Primer
(F):5'- GTCAAGGTGAATTTTCCATCAATTG -3'
(R):5'- AGGTACAGGTCTGCCTTTATTATTC -3'
Posted On 2022-02-07