Incidental Mutation 'R9182:Dnah7b'
ID 697053
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms Dnahc7b, LOC227058
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9182 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46066315-46373546 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46290878 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 3294 (I3294T)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069293
AA Change: I3294T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: I3294T

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,095,607 M190K probably damaging Het
4833423E24Rik T C 2: 85,500,237 H242R probably benign Het
4931406B18Rik A G 7: 43,504,216 W3R probably damaging Het
Acap3 T C 4: 155,905,435 L720P probably damaging Het
Actc1 T C 2: 114,052,013 T7A probably benign Het
Angpt2 T A 8: 18,710,642 probably null Het
Babam2 T A 5: 31,901,057 D228E possibly damaging Het
BC067074 A G 13: 113,320,824 N1135D Het
Ccar1 G A 10: 62,785,568 L34F probably damaging Het
Ccdc83 T C 7: 90,236,894 D219G probably damaging Het
Cct2 A G 10: 117,056,120 V341A probably benign Het
Cdc20b G A 13: 113,071,969 probably null Het
Chd7 T A 4: 8,838,737 L1312Q probably damaging Het
Cltc G A 11: 86,705,156 T1252I probably damaging Het
Cnpy1 G T 5: 28,245,801 D2E possibly damaging Het
Crat C T 2: 30,408,073 V205M probably damaging Het
Dgkb T C 12: 38,166,777 probably null Het
Dglucy T C 12: 100,844,769 V254A possibly damaging Het
Disp3 A G 4: 148,270,384 S392P probably damaging Het
Dlx6 A T 6: 6,863,456 Q26L probably benign Het
Dnah3 T C 7: 120,085,128 D258G probably damaging Het
Dnah6 A T 6: 73,144,705 Y1431* probably null Het
Dnaic2 A G 11: 114,733,013 N34S probably benign Het
Dock2 T C 11: 34,310,398 K981R possibly damaging Het
Entpd8 T C 2: 25,081,919 I33T probably benign Het
Eppk1 A G 15: 76,111,253 L476P probably benign Het
Etv1 T A 12: 38,780,717 probably null Het
Fam193a T A 5: 34,466,017 N1316K possibly damaging Het
Fkbp4 T C 6: 128,438,419 E31G probably benign Het
Fnbp1l C T 3: 122,569,696 D81N probably damaging Het
Fstl4 T C 11: 53,134,078 V259A probably damaging Het
Glipr1l1 T C 10: 112,076,151 S197P probably damaging Het
Gm4450 C T 3: 98,446,689 A165T possibly damaging Het
Gprin3 A T 6: 59,354,212 M370K probably benign Het
Gsc G T 12: 104,472,861 Y85* probably null Het
Gys2 T G 6: 142,446,009 Y509S probably damaging Het
Gys2 T C 6: 142,461,252 N126S possibly damaging Het
Hmcn1 A T 1: 150,612,654 W4292R probably damaging Het
Hmcn1 C A 1: 150,624,586 E3952* probably null Het
Htr1f T C 16: 64,926,462 M156V probably benign Het
Il21r G A 7: 125,629,041 G228E probably benign Het
Kat6b C T 14: 21,517,119 S82L probably benign Het
Kntc1 T A 5: 123,802,292 L1651Q probably damaging Het
Lipi G T 16: 75,560,785 Y297* probably null Het
Mapre3 T C 5: 30,864,672 S190P possibly damaging Het
Mmp8 T A 9: 7,567,466 Y442* probably null Het
Mt3 G A 8: 94,153,987 E62K unknown Het
Mut A G 17: 40,941,419 E284G probably damaging Het
Myh13 A G 11: 67,337,753 E373G probably damaging Het
Myh7 T C 14: 54,988,917 Y422C probably damaging Het
Nalcn A G 14: 123,596,604 V53A probably damaging Het
Nucb2 A G 7: 116,521,835 probably null Het
Olfr449 A T 6: 42,838,076 N65I probably benign Het
Olfr537-ps1 A T 7: 140,538,869 L117F probably benign Het
Olfr555 A T 7: 102,659,720 I300L probably damaging Het
Olfr620 T C 7: 103,611,856 K166E possibly damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Olfr923 C A 9: 38,827,876 H56N probably damaging Het
Opn5 A T 17: 42,592,999 H148Q probably damaging Het
Osmr T A 15: 6,821,088 D679V probably damaging Het
Pde4dip T C 3: 97,694,998 D2305G probably benign Het
Pdgfrl A T 8: 40,976,959 Q121L probably damaging Het
Pls1 C A 9: 95,776,758 V226F probably damaging Het
Plxnd1 T A 6: 115,993,785 I341F probably damaging Het
Ppfia2 T A 10: 106,927,779 M1211K probably benign Het
Ppfibp2 T A 7: 107,708,846 Y229N possibly damaging Het
Prss53 A G 7: 127,888,382 S266P probably benign Het
Pycr2 C T 1: 180,906,832 Q226* probably null Het
Rad50 T C 11: 53,692,763 H397R probably benign Het
Raf1 T C 6: 115,623,479 E393G probably damaging Het
Reln T C 5: 21,901,619 D3251G probably benign Het
Robo4 A T 9: 37,401,910 probably benign Het
Sbf1 A T 15: 89,289,603 probably null Het
Serpinb6a T C 13: 33,925,377 D145G probably damaging Het
Setx T A 2: 29,171,287 M2236K probably damaging Het
Sgms1 A G 19: 32,124,358 V416A probably benign Het
Six5 T G 7: 19,097,007 S520A probably benign Het
Sox5 T A 6: 143,833,392 I722F possibly damaging Het
Spag17 T G 3: 100,058,842 I1147S possibly damaging Het
Spice1 C T 16: 44,385,702 T842I possibly damaging Het
Ssbp2 A G 13: 91,700,681 T358A probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tbc1d2b C A 9: 90,270,599 C38F probably damaging Het
Tecrl C A 5: 83,309,202 probably null Het
Tgm7 T C 2: 121,096,499 N390D probably benign Het
Thsd4 T G 9: 59,987,366 M770L probably benign Het
Tmod2 C A 9: 75,597,342 probably benign Het
Tnks A G 8: 34,841,751 probably null Het
Tox3 T C 8: 90,257,879 N224S probably benign Het
Trappc10 C T 10: 78,214,630 E326K probably damaging Het
Usp16 T A 16: 87,479,654 F627I probably benign Het
Vcam1 T C 3: 116,117,355 I465V probably benign Het
Vmn1r128 T C 7: 21,349,758 I129T possibly damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r2 A T 3: 64,137,381 C115S probably damaging Het
Vmn2r85 A C 10: 130,429,481 S44R probably benign Het
Wasf3 T A 5: 146,466,825 Y248* probably null Het
Yipf5 A T 18: 40,210,798 L127M probably damaging Het
Zbp1 G T 2: 173,209,140 C312* probably null Het
Zfp423 A T 8: 87,782,114 F534Y probably damaging Het
Zfp69 T G 4: 120,935,111 Y156S probably damaging Het
Zmat4 A G 8: 23,929,210 N155S probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
BB001:Dnah7b UTSW 1 46219430 missense probably benign 0.04
BB011:Dnah7b UTSW 1 46219430 missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 splice site probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
R7760:Dnah7b UTSW 1 46201253 missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46137474 missense probably benign
R7807:Dnah7b UTSW 1 46214367 missense probably benign
R7895:Dnah7b UTSW 1 46249950 missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46139678 missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46219430 missense probably benign 0.04
R7944:Dnah7b UTSW 1 46227003 missense probably benign
R7946:Dnah7b UTSW 1 46233579 missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46243424 missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46243365 missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46224706 nonsense probably null
R8094:Dnah7b UTSW 1 46126804 missense probably benign 0.01
R8137:Dnah7b UTSW 1 46233753 missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46253511 missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46356576 missense probably benign 0.43
R8309:Dnah7b UTSW 1 46139872 missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46175296 missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46356659 critical splice donor site probably null
R8438:Dnah7b UTSW 1 46188679 missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46290715 missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46099490 missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46116200 missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46175438 missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46182464 missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46352999 missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46123646 missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46234145 missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46191793 missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46241076 missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46253374 missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46223072 missense probably benign 0.00
R9058:Dnah7b UTSW 1 46243415 missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46134514 missense probably benign 0.01
R9131:Dnah7b UTSW 1 46227020 missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46142034 missense probably damaging 1.00
R9223:Dnah7b UTSW 1 46322260 missense probably benign 0.12
R9391:Dnah7b UTSW 1 46233754 nonsense probably null
R9392:Dnah7b UTSW 1 46123738 nonsense probably null
R9456:Dnah7b UTSW 1 46126793 missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46214404 missense probably benign 0.27
R9553:Dnah7b UTSW 1 46225796 missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46253461 missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46213384 missense not run
RF020:Dnah7b UTSW 1 46373261 missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAGTTCTCTCACTATCAGAAGGC -3'
(R):5'- GCTCTGTAAACCATTATTTCCCAG -3'

Sequencing Primer
(F):5'- TTTCTCAGAAGCAGGAAGTGGC -3'
(R):5'- GCTAAAGCTACACACTTCTGTTC -3'
Posted On 2022-02-07