Incidental Mutation 'R9182:Dnah6'
ID 697087
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Name dynein, axonemal, heavy chain 6
Synonyms A730004I20Rik, Dnahc6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R9182 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 73017606-73221651 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 73144705 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1431 (Y1431*)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000064948
AA Change: Y1431*
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: Y1431*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114040
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204053
AA Change: Y1431*
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: Y1431*

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,095,607 M190K probably damaging Het
4833423E24Rik T C 2: 85,500,237 H242R probably benign Het
4931406B18Rik A G 7: 43,504,216 W3R probably damaging Het
Acap3 T C 4: 155,905,435 L720P probably damaging Het
Actc1 T C 2: 114,052,013 T7A probably benign Het
Angpt2 T A 8: 18,710,642 probably null Het
Babam2 T A 5: 31,901,057 D228E possibly damaging Het
BC067074 A G 13: 113,320,824 N1135D Het
Ccar1 G A 10: 62,785,568 L34F probably damaging Het
Ccdc83 T C 7: 90,236,894 D219G probably damaging Het
Cct2 A G 10: 117,056,120 V341A probably benign Het
Cdc20b G A 13: 113,071,969 probably null Het
Chd7 T A 4: 8,838,737 L1312Q probably damaging Het
Cltc G A 11: 86,705,156 T1252I probably damaging Het
Cnpy1 G T 5: 28,245,801 D2E possibly damaging Het
Crat C T 2: 30,408,073 V205M probably damaging Het
Dgkb T C 12: 38,166,777 probably null Het
Dglucy T C 12: 100,844,769 V254A possibly damaging Het
Disp3 A G 4: 148,270,384 S392P probably damaging Het
Dlx6 A T 6: 6,863,456 Q26L probably benign Het
Dnah3 T C 7: 120,085,128 D258G probably damaging Het
Dnah7b T C 1: 46,290,878 I3294T probably benign Het
Dnaic2 A G 11: 114,733,013 N34S probably benign Het
Dock2 T C 11: 34,310,398 K981R possibly damaging Het
Entpd8 T C 2: 25,081,919 I33T probably benign Het
Eppk1 A G 15: 76,111,253 L476P probably benign Het
Etv1 T A 12: 38,780,717 probably null Het
Fam193a T A 5: 34,466,017 N1316K possibly damaging Het
Fkbp4 T C 6: 128,438,419 E31G probably benign Het
Fnbp1l C T 3: 122,569,696 D81N probably damaging Het
Fstl4 T C 11: 53,134,078 V259A probably damaging Het
Glipr1l1 T C 10: 112,076,151 S197P probably damaging Het
Gm4450 C T 3: 98,446,689 A165T possibly damaging Het
Gprin3 A T 6: 59,354,212 M370K probably benign Het
Gsc G T 12: 104,472,861 Y85* probably null Het
Gys2 T G 6: 142,446,009 Y509S probably damaging Het
Gys2 T C 6: 142,461,252 N126S possibly damaging Het
Hmcn1 A T 1: 150,612,654 W4292R probably damaging Het
Hmcn1 C A 1: 150,624,586 E3952* probably null Het
Htr1f T C 16: 64,926,462 M156V probably benign Het
Il21r G A 7: 125,629,041 G228E probably benign Het
Kat6b C T 14: 21,517,119 S82L probably benign Het
Kntc1 T A 5: 123,802,292 L1651Q probably damaging Het
Lipi G T 16: 75,560,785 Y297* probably null Het
Mapre3 T C 5: 30,864,672 S190P possibly damaging Het
Mmp8 T A 9: 7,567,466 Y442* probably null Het
Mt3 G A 8: 94,153,987 E62K unknown Het
Mut A G 17: 40,941,419 E284G probably damaging Het
Myh13 A G 11: 67,337,753 E373G probably damaging Het
Myh7 T C 14: 54,988,917 Y422C probably damaging Het
Nalcn A G 14: 123,596,604 V53A probably damaging Het
Nucb2 A G 7: 116,521,835 probably null Het
Olfr449 A T 6: 42,838,076 N65I probably benign Het
Olfr537-ps1 A T 7: 140,538,869 L117F probably benign Het
Olfr555 A T 7: 102,659,720 I300L probably damaging Het
Olfr620 T C 7: 103,611,856 K166E possibly damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Olfr923 C A 9: 38,827,876 H56N probably damaging Het
Opn5 A T 17: 42,592,999 H148Q probably damaging Het
Osmr T A 15: 6,821,088 D679V probably damaging Het
Pde4dip T C 3: 97,694,998 D2305G probably benign Het
Pdgfrl A T 8: 40,976,959 Q121L probably damaging Het
Pls1 C A 9: 95,776,758 V226F probably damaging Het
Plxnd1 T A 6: 115,993,785 I341F probably damaging Het
Ppfia2 T A 10: 106,927,779 M1211K probably benign Het
Ppfibp2 T A 7: 107,708,846 Y229N possibly damaging Het
Prss53 A G 7: 127,888,382 S266P probably benign Het
Pycr2 C T 1: 180,906,832 Q226* probably null Het
Rad50 T C 11: 53,692,763 H397R probably benign Het
Raf1 T C 6: 115,623,479 E393G probably damaging Het
Reln T C 5: 21,901,619 D3251G probably benign Het
Robo4 A T 9: 37,401,910 probably benign Het
Sbf1 A T 15: 89,289,603 probably null Het
Serpinb6a T C 13: 33,925,377 D145G probably damaging Het
Setx T A 2: 29,171,287 M2236K probably damaging Het
Sgms1 A G 19: 32,124,358 V416A probably benign Het
Six5 T G 7: 19,097,007 S520A probably benign Het
Sox5 T A 6: 143,833,392 I722F possibly damaging Het
Spag17 T G 3: 100,058,842 I1147S possibly damaging Het
Spice1 C T 16: 44,385,702 T842I possibly damaging Het
Ssbp2 A G 13: 91,700,681 T358A probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tbc1d2b C A 9: 90,270,599 C38F probably damaging Het
Tecrl C A 5: 83,309,202 probably null Het
Tgm7 T C 2: 121,096,499 N390D probably benign Het
Thsd4 T G 9: 59,987,366 M770L probably benign Het
Tmod2 C A 9: 75,597,342 probably benign Het
Tnks A G 8: 34,841,751 probably null Het
Tox3 T C 8: 90,257,879 N224S probably benign Het
Trappc10 C T 10: 78,214,630 E326K probably damaging Het
Usp16 T A 16: 87,479,654 F627I probably benign Het
Vcam1 T C 3: 116,117,355 I465V probably benign Het
Vmn1r128 T C 7: 21,349,758 I129T possibly damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r2 A T 3: 64,137,381 C115S probably damaging Het
Vmn2r85 A C 10: 130,429,481 S44R probably benign Het
Wasf3 T A 5: 146,466,825 Y248* probably null Het
Yipf5 A T 18: 40,210,798 L127M probably damaging Het
Zbp1 G T 2: 173,209,140 C312* probably null Het
Zfp423 A T 8: 87,782,114 F534Y probably damaging Het
Zfp69 T G 4: 120,935,111 Y156S probably damaging Het
Zmat4 A G 8: 23,929,210 N155S probably damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 splice site probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 splice site probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73169080 splice site probably null
R7735:Dnah6 UTSW 6 73069429 missense probably damaging 1.00
R7754:Dnah6 UTSW 6 73025720 missense probably benign 0.41
R7829:Dnah6 UTSW 6 73127919 nonsense probably null
R7904:Dnah6 UTSW 6 73135467 splice site probably null
R8034:Dnah6 UTSW 6 73129225 missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73160913 missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73025786 missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73060225 missense probably benign 0.16
R8206:Dnah6 UTSW 6 73037566 nonsense probably null
R8214:Dnah6 UTSW 6 73044728 missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73168827 critical splice donor site probably null
R8273:Dnah6 UTSW 6 73076599 missense probably benign 0.31
R8273:Dnah6 UTSW 6 73195681 missense probably benign 0.00
R8331:Dnah6 UTSW 6 73025000 missense probably benign 0.10
R8350:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8428:Dnah6 UTSW 6 73074651 missense probably benign 0.15
R8447:Dnah6 UTSW 6 73138774 missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8517:Dnah6 UTSW 6 73178457 missense probably benign 0.16
R8523:Dnah6 UTSW 6 73095188 missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73168867 missense probably damaging 1.00
R8700:Dnah6 UTSW 6 73075890 intron probably benign
R8737:Dnah6 UTSW 6 73067445 missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73179828 missense possibly damaging 0.83
R8804:Dnah6 UTSW 6 73065773 missense probably benign
R8809:Dnah6 UTSW 6 73032563 missense possibly damaging 0.94
R8813:Dnah6 UTSW 6 73127954 missense probably damaging 1.00
R8849:Dnah6 UTSW 6 73144173 critical splice acceptor site probably null
R8867:Dnah6 UTSW 6 73021148 missense probably damaging 1.00
R8882:Dnah6 UTSW 6 73178498 missense probably benign 0.05
R8973:Dnah6 UTSW 6 73144751 missense probably benign 0.39
R9049:Dnah6 UTSW 6 73142292 missense probably damaging 1.00
R9053:Dnah6 UTSW 6 73084657 missense possibly damaging 0.94
R9064:Dnah6 UTSW 6 73149173 missense probably benign 0.00
R9077:Dnah6 UTSW 6 73144046 nonsense probably null
R9102:Dnah6 UTSW 6 73067486 missense probably benign
R9106:Dnah6 UTSW 6 73144769 missense probably damaging 1.00
R9119:Dnah6 UTSW 6 73060203 missense possibly damaging 0.95
R9124:Dnah6 UTSW 6 73121899 missense possibly damaging 0.78
R9165:Dnah6 UTSW 6 73144941 missense probably damaging 1.00
R9200:Dnah6 UTSW 6 73027514 missense probably benign 0.06
R9265:Dnah6 UTSW 6 73083057 missense probably benign 0.02
R9368:Dnah6 UTSW 6 73021278 missense probably benign 0.22
R9378:Dnah6 UTSW 6 73212530 missense probably benign
R9439:Dnah6 UTSW 6 73035347 missense possibly damaging 0.66
RF002:Dnah6 UTSW 6 73101889 missense probably benign
RF020:Dnah6 UTSW 6 73118057 missense probably benign 0.00
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Z1176:Dnah6 UTSW 6 73087783 missense possibly damaging 0.79
Z1176:Dnah6 UTSW 6 73133559 missense probably benign
Z1177:Dnah6 UTSW 6 73021237 missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73032526 missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 73041138 missense probably damaging 1.00
Z1177:Dnah6 UTSW 6 73155272 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATATACTCGCAGACTCAGGC -3'
(R):5'- ATATAGTTTCTGAGCTGGTTCAAGC -3'

Sequencing Primer
(F):5'- GCAGACTCAGGCGCACAAATC -3'
(R):5'- GGTTCAAGCCAAGGTAAATGCTTC -3'
Posted On 2022-02-07