Incidental Mutation 'R9182:Plxnd1'
ID 697089
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9182 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115993785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 341 (I341F)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: I341F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: I341F

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik A T 5: 113,095,607 M190K probably damaging Het
4833423E24Rik T C 2: 85,500,237 H242R probably benign Het
4931406B18Rik A G 7: 43,504,216 W3R probably damaging Het
Acap3 T C 4: 155,905,435 L720P probably damaging Het
Actc1 T C 2: 114,052,013 T7A probably benign Het
Angpt2 T A 8: 18,710,642 probably null Het
Babam2 T A 5: 31,901,057 D228E possibly damaging Het
BC067074 A G 13: 113,320,824 N1135D Het
Ccar1 G A 10: 62,785,568 L34F probably damaging Het
Ccdc83 T C 7: 90,236,894 D219G probably damaging Het
Cct2 A G 10: 117,056,120 V341A probably benign Het
Cdc20b G A 13: 113,071,969 probably null Het
Chd7 T A 4: 8,838,737 L1312Q probably damaging Het
Cltc G A 11: 86,705,156 T1252I probably damaging Het
Cnpy1 G T 5: 28,245,801 D2E possibly damaging Het
Crat C T 2: 30,408,073 V205M probably damaging Het
Dgkb T C 12: 38,166,777 probably null Het
Dglucy T C 12: 100,844,769 V254A possibly damaging Het
Disp3 A G 4: 148,270,384 S392P probably damaging Het
Dlx6 A T 6: 6,863,456 Q26L probably benign Het
Dnah3 T C 7: 120,085,128 D258G probably damaging Het
Dnah6 A T 6: 73,144,705 Y1431* probably null Het
Dnah7b T C 1: 46,290,878 I3294T probably benign Het
Dnaic2 A G 11: 114,733,013 N34S probably benign Het
Dock2 T C 11: 34,310,398 K981R possibly damaging Het
Entpd8 T C 2: 25,081,919 I33T probably benign Het
Eppk1 A G 15: 76,111,253 L476P probably benign Het
Etv1 T A 12: 38,780,717 probably null Het
Fam193a T A 5: 34,466,017 N1316K possibly damaging Het
Fkbp4 T C 6: 128,438,419 E31G probably benign Het
Fnbp1l C T 3: 122,569,696 D81N probably damaging Het
Fstl4 T C 11: 53,134,078 V259A probably damaging Het
Glipr1l1 T C 10: 112,076,151 S197P probably damaging Het
Gm4450 C T 3: 98,446,689 A165T possibly damaging Het
Gprin3 A T 6: 59,354,212 M370K probably benign Het
Gsc G T 12: 104,472,861 Y85* probably null Het
Gys2 T G 6: 142,446,009 Y509S probably damaging Het
Gys2 T C 6: 142,461,252 N126S possibly damaging Het
Hmcn1 A T 1: 150,612,654 W4292R probably damaging Het
Hmcn1 C A 1: 150,624,586 E3952* probably null Het
Htr1f T C 16: 64,926,462 M156V probably benign Het
Il21r G A 7: 125,629,041 G228E probably benign Het
Kat6b C T 14: 21,517,119 S82L probably benign Het
Kntc1 T A 5: 123,802,292 L1651Q probably damaging Het
Lipi G T 16: 75,560,785 Y297* probably null Het
Mapre3 T C 5: 30,864,672 S190P possibly damaging Het
Mmp8 T A 9: 7,567,466 Y442* probably null Het
Mt3 G A 8: 94,153,987 E62K unknown Het
Mut A G 17: 40,941,419 E284G probably damaging Het
Myh13 A G 11: 67,337,753 E373G probably damaging Het
Myh7 T C 14: 54,988,917 Y422C probably damaging Het
Nalcn A G 14: 123,596,604 V53A probably damaging Het
Nucb2 A G 7: 116,521,835 probably null Het
Olfr449 A T 6: 42,838,076 N65I probably benign Het
Olfr537-ps1 A T 7: 140,538,869 L117F probably benign Het
Olfr555 A T 7: 102,659,720 I300L probably damaging Het
Olfr620 T C 7: 103,611,856 K166E possibly damaging Het
Olfr828 G T 9: 18,815,446 Q283K probably damaging Het
Olfr923 C A 9: 38,827,876 H56N probably damaging Het
Opn5 A T 17: 42,592,999 H148Q probably damaging Het
Osmr T A 15: 6,821,088 D679V probably damaging Het
Pde4dip T C 3: 97,694,998 D2305G probably benign Het
Pdgfrl A T 8: 40,976,959 Q121L probably damaging Het
Pls1 C A 9: 95,776,758 V226F probably damaging Het
Ppfia2 T A 10: 106,927,779 M1211K probably benign Het
Ppfibp2 T A 7: 107,708,846 Y229N possibly damaging Het
Prss53 A G 7: 127,888,382 S266P probably benign Het
Pycr2 C T 1: 180,906,832 Q226* probably null Het
Rad50 T C 11: 53,692,763 H397R probably benign Het
Raf1 T C 6: 115,623,479 E393G probably damaging Het
Reln T C 5: 21,901,619 D3251G probably benign Het
Robo4 A T 9: 37,401,910 probably benign Het
Sbf1 A T 15: 89,289,603 probably null Het
Serpinb6a T C 13: 33,925,377 D145G probably damaging Het
Setx T A 2: 29,171,287 M2236K probably damaging Het
Sgms1 A G 19: 32,124,358 V416A probably benign Het
Six5 T G 7: 19,097,007 S520A probably benign Het
Sox5 T A 6: 143,833,392 I722F possibly damaging Het
Spag17 T G 3: 100,058,842 I1147S possibly damaging Het
Spice1 C T 16: 44,385,702 T842I possibly damaging Het
Ssbp2 A G 13: 91,700,681 T358A probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tbc1d2b C A 9: 90,270,599 C38F probably damaging Het
Tecrl C A 5: 83,309,202 probably null Het
Tgm7 T C 2: 121,096,499 N390D probably benign Het
Thsd4 T G 9: 59,987,366 M770L probably benign Het
Tmod2 C A 9: 75,597,342 probably benign Het
Tnks A G 8: 34,841,751 probably null Het
Tox3 T C 8: 90,257,879 N224S probably benign Het
Trappc10 C T 10: 78,214,630 E326K probably damaging Het
Usp16 T A 16: 87,479,654 F627I probably benign Het
Vcam1 T C 3: 116,117,355 I465V probably benign Het
Vmn1r128 T C 7: 21,349,758 I129T possibly damaging Het
Vmn1r217 T A 13: 23,114,325 I136L probably benign Het
Vmn2r2 A T 3: 64,137,381 C115S probably damaging Het
Vmn2r85 A C 10: 130,429,481 S44R probably benign Het
Wasf3 T A 5: 146,466,825 Y248* probably null Het
Yipf5 A T 18: 40,210,798 L127M probably damaging Het
Zbp1 G T 2: 173,209,140 C312* probably null Het
Zfp423 A T 8: 87,782,114 F534Y probably damaging Het
Zfp69 T G 4: 120,935,111 Y156S probably damaging Het
Zmat4 A G 8: 23,929,210 N155S probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACCTGTATGTTGCGCTTGC -3'
(R):5'- CGGACGATAACATCCTGAAGATC -3'

Sequencing Primer
(F):5'- TGCACGAATGGCAGCCTG -3'
(R):5'- ACAAGCTGGGCTTCGTG -3'
Posted On 2022-02-07