Incidental Mutation 'R9183:Muc5ac'
ID 697183
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141788972-141819231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141798900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 709 (Y709F)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000041924
AA Change: Y708F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: Y708F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155534
AA Change: Y709F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: Y709F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163321
AA Change: Y708F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: Y708F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 A G 14: 8,251,559 C313R probably damaging Het
Adap2 A G 11: 80,155,056 N54S probably damaging Het
Adcy8 T C 15: 64,822,267 D387G probably damaging Het
Adgra1 G A 7: 139,875,800 R448Q probably benign Het
Antxr1 A T 6: 87,287,043 D148E probably damaging Het
Ap3d1 A T 10: 80,709,793 V1034E probably null Het
Arpp21 C T 9: 112,065,998 A731T probably benign Het
Asl T A 5: 130,013,471 R255W probably damaging Het
Asxl1 T A 2: 153,397,920 S544T probably damaging Het
Atp8a1 A C 5: 67,767,035 Y329D Het
Calcr A T 6: 3,711,463 I186N probably damaging Het
Cdh18 T C 15: 23,226,979 probably null Het
Celsr3 T C 9: 108,829,396 L1026P probably damaging Het
Ces2a T A 8: 104,734,142 V24E possibly damaging Het
Clybl T C 14: 122,401,975 I317T probably damaging Het
Col13a1 T A 10: 61,863,979 T476S unknown Het
Cyp4f15 T C 17: 32,700,231 S343P probably damaging Het
D230025D16Rik C A 8: 105,231,208 Q49K probably benign Het
D630003M21Rik T C 2: 158,217,192 T263A probably benign Het
Fbxo28 A G 1: 182,329,961 V97A possibly damaging Het
Frem2 C T 3: 53,520,065 V2889I probably damaging Het
Garnl3 T C 2: 33,005,068 E663G probably damaging Het
Gen1 T A 12: 11,249,185 K338M probably damaging Het
Gfi1 A G 5: 107,725,953 probably null Het
Gfod2 A G 8: 105,723,021 S95P probably benign Het
H2-Bl T A 17: 36,081,490 H31L unknown Het
Heatr1 A G 13: 12,421,385 Q1224R probably damaging Het
Hectd4 A G 5: 121,299,488 K1059E possibly damaging Het
Hmgcs2 C T 3: 98,290,916 A45V possibly damaging Het
Hnmt C A 2: 24,003,643 V280L probably benign Het
Ifi35 G T 11: 101,457,265 V66L probably benign Het
Kcnn2 T C 18: 45,561,312 I188T probably damaging Het
Klhl8 C A 5: 103,864,245 A575S probably benign Het
Krt6a T C 15: 101,693,011 D225G probably benign Het
Lrtm2 T C 6: 119,317,423 Y249C probably damaging Het
Med12l C T 3: 59,077,077 R479C probably damaging Het
Nsd2 G A 5: 33,871,452 A162T probably damaging Het
Olfr768 A G 10: 129,093,332 M214T probably benign Het
Polr2h T C 16: 20,720,535 Y90H possibly damaging Het
Prkaa1 A T 15: 5,176,488 E275V probably damaging Het
Prss22 C T 17: 23,994,618 G233E probably damaging Het
Rhcg A T 7: 79,594,816 L496* probably null Het
Rnf213 A G 11: 119,427,622 E1084G Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Slc14a1 T A 18: 78,111,383 I263F probably benign Het
Slc40a1 C T 1: 45,909,511 M536I possibly damaging Het
Slco6c1 T A 1: 97,069,050 probably null Het
Stk32a T C 18: 43,261,340 F118S probably damaging Het
Sytl1 G T 4: 133,253,623 R467S possibly damaging Het
Thbs2 T C 17: 14,676,264 I788V probably benign Het
Tmed6 T A 8: 107,061,758 R186* probably null Het
Trnau1ap G A 4: 132,325,254 R78C probably damaging Het
Trpv1 A T 11: 73,244,213 D412V possibly damaging Het
Ttc16 C T 2: 32,757,317 V688M probably benign Het
Ubr5 C A 15: 37,997,176 L1738F Het
Vmn2r89 A G 14: 51,455,044 I101M probably benign Het
Wdr27 C T 17: 14,928,389 R114Q possibly damaging Het
Wdr48 A G 9: 119,920,664 H563R possibly damaging Het
Wdr49 A C 3: 75,298,112 S666A probably benign Het
Wwox T C 8: 114,706,370 S259P probably damaging Het
Zfp160 T A 17: 21,020,092 D12E possibly damaging Het
Zfp800 A G 6: 28,243,173 Y598H probably benign Het
Zfp970 T C 2: 177,475,743 L370P probably damaging Het
Zmat5 A T 11: 4,722,431 D16V probably damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141812703 missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141807473 missense probably benign 0.12
IGL01155:Muc5ac APN 7 141806943 splice site probably benign
IGL01452:Muc5ac APN 7 141817555 missense probably benign 0.00
IGL01590:Muc5ac APN 7 141798893 missense probably benign 0.02
IGL02104:Muc5ac APN 7 141811078 missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141800177 missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141818800 nonsense probably null
IGL02178:Muc5ac APN 7 141805447 splice site probably benign
IGL02403:Muc5ac APN 7 141803450 missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141817044 missense probably benign 0.01
IGL02665:Muc5ac APN 7 141791086 missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141795263 missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141805775 missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141813781 missense probably benign 0.34
IGL03384:Muc5ac APN 7 141812403 missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141795213 missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141807416 missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141818630 missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141795275 missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141811039 missense probably benign 0.08
R0363:Muc5ac UTSW 7 141800960 missense probably benign 0.01
R0384:Muc5ac UTSW 7 141812251 missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141792034 nonsense probably null
R0583:Muc5ac UTSW 7 141807608 missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141796244 missense probably benign 0.02
R0682:Muc5ac UTSW 7 141805669 missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141807709 missense probably benign 0.03
R0883:Muc5ac UTSW 7 141796265 missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141807515 missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141816929 missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141807323 missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141807377 missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141813892 splice site probably null
R1599:Muc5ac UTSW 7 141798903 missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141801531 missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141807086 missense probably benign 0.00
R1911:Muc5ac UTSW 7 141796304 missense probably benign 0.18
R1922:Muc5ac UTSW 7 141793689 missense probably benign 0.03
R1966:Muc5ac UTSW 7 141803376 missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141813152 missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141792035 missense probably benign 0.01
R2126:Muc5ac UTSW 7 141810742 missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141812347 missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2259:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2293:Muc5ac UTSW 7 141807199 missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141818104 missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141791140 missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141807641 missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141792736 splice site probably null
R3762:Muc5ac UTSW 7 141807475 missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141798501 missense probably benign 0.32
R3806:Muc5ac UTSW 7 141813734 missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141814723 missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141791224 missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141802892 missense probably benign
R3981:Muc5ac UTSW 7 141813775 missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141799844 critical splice donor site probably null
R4043:Muc5ac UTSW 7 141807478 missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141811130 missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141802835 missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141817110 missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141791103 missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141789763 missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141817601 missense probably benign 0.00
R4789:Muc5ac UTSW 7 141798882 missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141817902 nonsense probably null
R4971:Muc5ac UTSW 7 141816278 missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141809456 intron probably benign
R5088:Muc5ac UTSW 7 141796319 missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141814742 missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141793971 missense probably benign 0.32
R5366:Muc5ac UTSW 7 141807550 missense probably benign 0.01
R5497:Muc5ac UTSW 7 141807643 missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141807832 missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141793715 critical splice donor site probably null
R5811:Muc5ac UTSW 7 141798984 missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141817907 missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141790669 nonsense probably null
R5977:Muc5ac UTSW 7 141796367 missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141811857 missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141801232 missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141815586 missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141789795 missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141816864 nonsense probably null
R6341:Muc5ac UTSW 7 141801492 missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141812679 missense probably benign 0.05
R6481:Muc5ac UTSW 7 141809071 intron probably benign
R6483:Muc5ac UTSW 7 141802854 missense probably benign 0.18
R6627:Muc5ac UTSW 7 141808690 intron probably benign
R6636:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141803328 missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141798992 missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141809552 intron probably benign
R6844:Muc5ac UTSW 7 141809744 intron probably benign
R6847:Muc5ac UTSW 7 141809744 intron probably benign
R6852:Muc5ac UTSW 7 141816907 missense probably benign 0.03
R6862:Muc5ac UTSW 7 141809744 intron probably benign
R6863:Muc5ac UTSW 7 141809744 intron probably benign
R6864:Muc5ac UTSW 7 141809744 intron probably benign
R6865:Muc5ac UTSW 7 141809744 intron probably benign
R6874:Muc5ac UTSW 7 141809744 intron probably benign
R6875:Muc5ac UTSW 7 141809744 intron probably benign
R6876:Muc5ac UTSW 7 141809744 intron probably benign
R6877:Muc5ac UTSW 7 141809744 intron probably benign
R6889:Muc5ac UTSW 7 141809744 intron probably benign
R6920:Muc5ac UTSW 7 141793298 missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141818714 missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141809687 intron probably benign
R7091:Muc5ac UTSW 7 141809687 intron probably benign
R7092:Muc5ac UTSW 7 141809648 intron probably benign
R7092:Muc5ac UTSW 7 141809687 intron probably benign
R7110:Muc5ac UTSW 7 141799822 missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141813822 nonsense probably null
R7238:Muc5ac UTSW 7 141809517 missense unknown
R7238:Muc5ac UTSW 7 141809687 intron probably benign
R7396:Muc5ac UTSW 7 141808415 missense unknown
R7456:Muc5ac UTSW 7 141793167 missense probably benign 0.32
R7477:Muc5ac UTSW 7 141816282 missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141813799 missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141808668 missense unknown
R7604:Muc5ac UTSW 7 141809709 missense unknown
R7635:Muc5ac UTSW 7 141805676 missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141805753 missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141809422 missense unknown
R7651:Muc5ac UTSW 7 141796254 missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141809383 missense unknown
R7720:Muc5ac UTSW 7 141809303 missense unknown
R7749:Muc5ac UTSW 7 141809303 missense unknown
R7750:Muc5ac UTSW 7 141809303 missense unknown
R7751:Muc5ac UTSW 7 141809303 missense unknown
R7754:Muc5ac UTSW 7 141809303 missense unknown
R7798:Muc5ac UTSW 7 141794041 critical splice donor site probably null
R7835:Muc5ac UTSW 7 141809303 missense unknown
R7837:Muc5ac UTSW 7 141815963 missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141803429 missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141795852 missense probably benign 0.00
R7874:Muc5ac UTSW 7 141809303 missense unknown
R7876:Muc5ac UTSW 7 141809303 missense unknown
R7877:Muc5ac UTSW 7 141809303 missense unknown
R7881:Muc5ac UTSW 7 141809303 missense unknown
R7884:Muc5ac UTSW 7 141809303 missense unknown
R7921:Muc5ac UTSW 7 141809687 intron probably benign
R7976:Muc5ac UTSW 7 141809791 missense unknown
R8104:Muc5ac UTSW 7 141804783 missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141807331 missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141802948 missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141809263 missense unknown
R8386:Muc5ac UTSW 7 141807634 missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141810476 missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141807155 missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141816926 missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141809744 intron probably benign
R8727:Muc5ac UTSW 7 141809744 intron probably benign
R8754:Muc5ac UTSW 7 141800271 missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141818872 missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141789756 missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141793354 missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141808975 missense unknown
R9124:Muc5ac UTSW 7 141809792 missense unknown
R9131:Muc5ac UTSW 7 141809792 missense unknown
R9132:Muc5ac UTSW 7 141809792 missense unknown
R9135:Muc5ac UTSW 7 141798481 missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141809792 missense unknown
R9157:Muc5ac UTSW 7 141809792 missense unknown
R9159:Muc5ac UTSW 7 141809792 missense unknown
R9160:Muc5ac UTSW 7 141809792 missense unknown
R9161:Muc5ac UTSW 7 141799289 missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141812356 missense possibly damaging 0.92
R9218:Muc5ac UTSW 7 141807361 missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141817063 nonsense probably null
R9239:Muc5ac UTSW 7 141800217 missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141810478 missense probably benign 0.11
R9287:Muc5ac UTSW 7 141807889 missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141815518 missense probably benign 0.01
R9327:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141808822 missense unknown
R9430:Muc5ac UTSW 7 141808832 missense unknown
R9454:Muc5ac UTSW 7 141808694 missense unknown
R9483:Muc5ac UTSW 7 141811728 nonsense probably null
R9581:Muc5ac UTSW 7 141810062 missense unknown
R9610:Muc5ac UTSW 7 141796341 missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141795864 missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141811061 missense probably benign 0.41
R9760:Muc5ac UTSW 7 141807248 missense probably benign 0.05
R9778:Muc5ac UTSW 7 141795284 nonsense probably null
X0060:Muc5ac UTSW 7 141803333 missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141809744 intron probably benign
Z1088:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
Z1177:Muc5ac UTSW 7 141809224 missense unknown
Z1177:Muc5ac UTSW 7 141818040 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCTCTGAAACTAAGGGAGAACCAAG -3'
(R):5'- ACAGACTCGCCATTGGGAAC -3'

Sequencing Primer
(F):5'- GGAGAACCAAGCCATTGTGACC -3'
(R):5'- AACTGTGGATCCCTTGTAGTAGCAAG -3'
Posted On 2022-02-07