Incidental Mutation 'R9183:Ces2a'
ID 697184
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 068950-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9183 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105460774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 24 (V24E)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect possibly damaging
Transcript: ENSMUST00000034346
AA Change: V24E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: V24E

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161824
AA Change: C39S
Predicted Effect probably damaging
Transcript: ENSMUST00000164182
AA Change: V24E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: V24E

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 A G 14: 8,251,559 (GRCm38) C313R probably damaging Het
Adap2 A G 11: 80,045,882 (GRCm39) N54S probably damaging Het
Adcy8 T C 15: 64,694,116 (GRCm39) D387G probably damaging Het
Adgra1 G A 7: 139,455,716 (GRCm39) R448Q probably benign Het
Antxr1 A T 6: 87,264,025 (GRCm39) D148E probably damaging Het
Ap3d1 A T 10: 80,545,627 (GRCm39) V1034E probably null Het
Arpp21 C T 9: 111,895,066 (GRCm39) A731T probably benign Het
Asl T A 5: 130,042,312 (GRCm39) R255W probably damaging Het
Asxl1 T A 2: 153,239,840 (GRCm39) S544T probably damaging Het
Atp8a1 A C 5: 67,924,378 (GRCm39) Y329D Het
Calcr A T 6: 3,711,463 (GRCm39) I186N probably damaging Het
Cdh18 T C 15: 23,227,065 (GRCm39) probably null Het
Celsr3 T C 9: 108,706,595 (GRCm39) L1026P probably damaging Het
Clybl T C 14: 122,639,387 (GRCm39) I317T probably damaging Het
Col13a1 T A 10: 61,699,758 (GRCm39) T476S unknown Het
Cyp4f15 T C 17: 32,919,205 (GRCm39) S343P probably damaging Het
D630003M21Rik T C 2: 158,059,112 (GRCm39) T263A probably benign Het
Fbxo28 A G 1: 182,157,526 (GRCm39) V97A possibly damaging Het
Frem2 C T 3: 53,427,486 (GRCm39) V2889I probably damaging Het
Garnl3 T C 2: 32,895,080 (GRCm39) E663G probably damaging Het
Gen1 T A 12: 11,299,186 (GRCm39) K338M probably damaging Het
Gfi1 A G 5: 107,873,819 (GRCm39) probably null Het
Gfod2 A G 8: 106,449,653 (GRCm39) S95P probably benign Het
H2-T13 T A 17: 36,392,382 (GRCm39) H31L unknown Het
Heatr1 A G 13: 12,436,266 (GRCm39) Q1224R probably damaging Het
Hectd4 A G 5: 121,437,551 (GRCm39) K1059E possibly damaging Het
Hmgcs2 C T 3: 98,198,232 (GRCm39) A45V possibly damaging Het
Hnmt C A 2: 23,893,655 (GRCm39) V280L probably benign Het
Ifi35 G T 11: 101,348,091 (GRCm39) V66L probably benign Het
Kcnn2 T C 18: 45,694,379 (GRCm39) I188T probably damaging Het
Klhl8 C A 5: 104,012,111 (GRCm39) A575S probably benign Het
Krt6a T C 15: 101,601,446 (GRCm39) D225G probably benign Het
Lrtm2 T C 6: 119,294,384 (GRCm39) Y249C probably damaging Het
Med12l C T 3: 58,984,498 (GRCm39) R479C probably damaging Het
Muc5ac A T 7: 141,352,637 (GRCm39) Y709F possibly damaging Het
Nsd2 G A 5: 34,028,796 (GRCm39) A162T probably damaging Het
Or6c38 A G 10: 128,929,201 (GRCm39) M214T probably benign Het
Phaf1 C A 8: 105,957,840 (GRCm39) Q49K probably benign Het
Polr2h T C 16: 20,539,285 (GRCm39) Y90H possibly damaging Het
Prkaa1 A T 15: 5,205,969 (GRCm39) E275V probably damaging Het
Prss22 C T 17: 24,213,592 (GRCm39) G233E probably damaging Het
Rhcg A T 7: 79,244,564 (GRCm39) L496* probably null Het
Rnf213 A G 11: 119,318,448 (GRCm39) E1084G Het
Safb2 ACTTCTTCT ACTTCT 17: 56,878,292 (GRCm39) probably benign Het
Slc14a1 T A 18: 78,154,598 (GRCm39) I263F probably benign Het
Slc40a1 C T 1: 45,948,671 (GRCm39) M536I possibly damaging Het
Slco6c1 T A 1: 96,996,775 (GRCm39) probably null Het
Stk32a T C 18: 43,394,405 (GRCm39) F118S probably damaging Het
Sytl1 G T 4: 132,980,934 (GRCm39) R467S possibly damaging Het
Thbs2 T C 17: 14,896,526 (GRCm39) I788V probably benign Het
Tmed6 T A 8: 107,788,390 (GRCm39) R186* probably null Het
Trnau1ap G A 4: 132,052,565 (GRCm39) R78C probably damaging Het
Trpv1 A T 11: 73,135,039 (GRCm39) D412V possibly damaging Het
Ttc16 C T 2: 32,647,329 (GRCm39) V688M probably benign Het
Ubr5 C A 15: 37,997,420 (GRCm39) L1738F Het
Vmn2r89 A G 14: 51,692,501 (GRCm39) I101M probably benign Het
Wdr27 C T 17: 15,148,651 (GRCm39) R114Q possibly damaging Het
Wdr48 A G 9: 119,749,730 (GRCm39) H563R possibly damaging Het
Wdr49 A C 3: 75,205,419 (GRCm39) S666A probably benign Het
Wwox T C 8: 115,433,110 (GRCm39) S259P probably damaging Het
Zfp160 T A 17: 21,240,354 (GRCm39) D12E possibly damaging Het
Zfp800 A G 6: 28,243,172 (GRCm39) Y598H probably benign Het
Zfp970 T C 2: 177,167,536 (GRCm39) L370P probably damaging Het
Zmat5 A T 11: 4,672,431 (GRCm39) D16V probably damaging Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCCCATCCAATCAAATGTC -3'
(R):5'- TCAGACATCTCTGATGCCCC -3'

Sequencing Primer
(F):5'- TCCAATCAAATGTCCACACCTAC -3'
(R):5'- CCCCATGTGCCCTGGTG -3'
Posted On 2022-02-07