Incidental Mutation 'R9184:Olfr48'
ID 697231
Institutional Source Beutler Lab
Gene Symbol Olfr48
Ensembl Gene ENSMUSG00000075072
Gene Name olfactory receptor 48
Synonyms IC3, MOR232-5, GA_x6K02T2Q125-51285881-51284976
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9184 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89841793-89848205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89844950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 8 (I8F)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
AlphaFold Q8VGN4
Predicted Effect probably benign
Transcript: ENSMUST00000099762
AA Change: I8F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: I8F

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably benign
Transcript: ENSMUST00000214428
AA Change: I8F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,271,388 L692S probably damaging Het
6030452D12Rik T C 8: 106,507,269 V199A unknown Het
Abca7 A G 10: 80,002,856 H621R probably damaging Het
Adam18 T A 8: 24,647,831 N331I probably benign Het
Akt1 A G 12: 112,654,718 S475P possibly damaging Het
Arc A G 15: 74,671,930 V148A probably damaging Het
Atg2a T C 19: 6,241,857 L21P probably damaging Het
C1qtnf2 T C 11: 43,474,353 V25A probably benign Het
Cald1 G T 6: 34,753,577 E244D unknown Het
Cdc42bpa T A 1: 180,144,736 F1368I probably benign Het
Cfap61 G A 2: 146,077,388 C680Y probably null Het
Chd1 T A 17: 15,742,289 N769K possibly damaging Het
Clasp1 T A 1: 118,543,178 V848E probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Ctsb G T 14: 63,138,095 G170V probably damaging Het
Dnah5 A G 15: 28,340,406 K2320E probably benign Het
Fat4 A T 3: 38,982,443 I3415F probably damaging Het
Fibcd1 A G 2: 31,816,476 S448P probably damaging Het
Filip1 T C 9: 79,898,260 K71E probably benign Het
Gad2 G A 2: 22,668,319 V350I probably benign Het
Gigyf2 T A 1: 87,440,589 S1032T possibly damaging Het
Glis3 T C 19: 28,531,607 T326A probably damaging Het
Hspa9 C T 18: 34,949,115 R146H possibly damaging Het
Jakmip2 A G 18: 43,582,287 I58T probably benign Het
Kcnk15 G A 2: 163,858,686 V282M probably benign Het
Klk1b8 A G 7: 43,952,734 N30S probably benign Het
Lpin2 T A 17: 71,233,916 Y454* probably null Het
Mms22l T C 4: 24,596,182 L1047S probably damaging Het
Neb A G 2: 52,328,755 I81T possibly damaging Het
Neurod4 A T 10: 130,271,089 D105E probably damaging Het
Nlrp1b A G 11: 71,181,241 L592P probably damaging Het
Nnt C A 13: 119,381,734 K302N probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr1195 C A 2: 88,683,175 A186S possibly damaging Het
Olfr828 T C 9: 18,815,842 I151V probably benign Het
Pcdhga4 A T 18: 37,687,407 I670F possibly damaging Het
Pdp1 T C 4: 11,962,143 E75G possibly damaging Het
Pds5b T A 5: 150,800,784 N1275K probably benign Het
Pink1 G T 4: 138,321,010 Q134K probably benign Het
Poli T A 18: 70,509,179 H650L probably damaging Het
Prickle2 G A 6: 92,411,524 P355L possibly damaging Het
Prkaca G A 8: 83,990,676 G194D probably benign Het
Ptgs2 A T 1: 150,104,424 Y371F probably damaging Het
Rarb C T 14: 16,818,881 probably benign Het
Rarb T A 14: 16,818,882 probably benign Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Serpinb1b T G 13: 33,085,410 V42G probably damaging Het
Sgsm2 T A 11: 74,892,008 I41F possibly damaging Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Slc26a7 C T 4: 14,506,630 V602M possibly damaging Het
Slu7 T C 11: 43,443,397 S417P probably damaging Het
Smad2 T A 18: 76,289,100 D194E probably benign Het
Sntg1 A T 1: 8,677,832 V112E probably damaging Het
Strip1 A T 3: 107,614,663 M733K probably benign Het
Szt2 G A 4: 118,384,529 S1655L possibly damaging Het
Ttn A T 2: 76,769,605 I19075N probably benign Het
Urb2 C T 8: 124,045,151 T1437I probably benign Het
Vmn2r111 T A 17: 22,571,841 I159F probably benign Het
Zfp78 T C 7: 6,379,301 V450A probably damaging Het
Zmynd11 T A 13: 9,693,439 H314L probably benign Het
Other mutations in Olfr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr48 APN 2 89844095 missense probably benign 0.00
IGL02184:Olfr48 APN 2 89844385 missense probably damaging 0.98
IGL02408:Olfr48 APN 2 89844971 start codon destroyed probably benign 0.04
IGL02437:Olfr48 APN 2 89844784 missense probably damaging 0.98
IGL02985:Olfr48 APN 2 89844340 missense possibly damaging 0.66
IGL03230:Olfr48 APN 2 89844113 missense probably benign
IGL03393:Olfr48 APN 2 89844569 missense probably benign 0.00
R0482:Olfr48 UTSW 2 89844169 missense probably benign 0.20
R0555:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R1268:Olfr48 UTSW 2 89844154 missense probably damaging 0.98
R1617:Olfr48 UTSW 2 89844254 missense probably benign 0.03
R3552:Olfr48 UTSW 2 89844343 missense possibly damaging 0.53
R4172:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4173:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4174:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R5540:Olfr48 UTSW 2 89844667 missense probably damaging 1.00
R5909:Olfr48 UTSW 2 89844391 missense possibly damaging 0.89
R5941:Olfr48 UTSW 2 89844515 missense probably benign 0.07
R7425:Olfr48 UTSW 2 89844445 missense probably damaging 0.99
R7445:Olfr48 UTSW 2 89844272 missense probably damaging 0.99
R7660:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R7978:Olfr48 UTSW 2 89844267 nonsense probably null
R7996:Olfr48 UTSW 2 89844415 missense probably benign 0.28
R8026:Olfr48 UTSW 2 89844929 missense probably benign 0.06
R9420:Olfr48 UTSW 2 89844371 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCATCTATCAGCGACAGGAAAG -3'
(R):5'- ACAGGTTCCACTCCAGACTTC -3'

Sequencing Primer
(F):5'- CATCTATCAGCGACAGGAAAGAGAGG -3'
(R):5'- CCAGTTAGTGGTTTCCAAATGTGCC -3'
Posted On 2022-02-07