Incidental Mutation 'R9184:Or4c58'
ID 697231
Institutional Source Beutler Lab
Gene Symbol Or4c58
Ensembl Gene ENSMUSG00000075072
Gene Name olfactory receptor family 4 subfamily C member 58
Synonyms Olfr48, IC3, GA_x6K02T2Q125-51285881-51284976, MOR232-5
MMRRC Submission 068979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9184 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89674410-89675315 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89675294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 8 (I8F)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
AlphaFold Q8VGN4
Predicted Effect probably benign
Transcript: ENSMUST00000099762
AA Change: I8F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: I8F

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably benign
Transcript: ENSMUST00000214428
AA Change: I8F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik T C 8: 107,233,901 (GRCm39) V199A unknown Het
Abca7 A G 10: 79,838,690 (GRCm39) H621R probably damaging Het
Adam18 T A 8: 25,137,847 (GRCm39) N331I probably benign Het
Akt1 A G 12: 112,621,152 (GRCm39) S475P possibly damaging Het
Arc A G 15: 74,543,779 (GRCm39) V148A probably damaging Het
Atg2a T C 19: 6,291,887 (GRCm39) L21P probably damaging Het
Bltp2 T C 11: 78,162,214 (GRCm39) L692S probably damaging Het
C1qtnf2 T C 11: 43,365,180 (GRCm39) V25A probably benign Het
Cald1 G T 6: 34,730,512 (GRCm39) E244D unknown Het
Cdc42bpa T A 1: 179,972,301 (GRCm39) F1368I probably benign Het
Cfap61 G A 2: 145,919,308 (GRCm39) C680Y probably null Het
Chd1 T A 17: 15,962,551 (GRCm39) N769K possibly damaging Het
Clasp1 T A 1: 118,470,908 (GRCm39) V848E probably benign Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Ctsb G T 14: 63,375,544 (GRCm39) G170V probably damaging Het
Dnah5 A G 15: 28,340,552 (GRCm39) K2320E probably benign Het
Fat4 A T 3: 39,036,592 (GRCm39) I3415F probably damaging Het
Fibcd1 A G 2: 31,706,488 (GRCm39) S448P probably damaging Het
Filip1 T C 9: 79,805,542 (GRCm39) K71E probably benign Het
Gad2 G A 2: 22,558,331 (GRCm39) V350I probably benign Het
Gigyf2 T A 1: 87,368,311 (GRCm39) S1032T possibly damaging Het
Glis3 T C 19: 28,509,007 (GRCm39) T326A probably damaging Het
Hspa9 C T 18: 35,082,168 (GRCm39) R146H possibly damaging Het
Jakmip2 A G 18: 43,715,352 (GRCm39) I58T probably benign Het
Kcnk15 G A 2: 163,700,606 (GRCm39) V282M probably benign Het
Klk1b8 A G 7: 43,602,158 (GRCm39) N30S probably benign Het
Lpin2 T A 17: 71,540,911 (GRCm39) Y454* probably null Het
Mcam T C 9: 44,046,545 (GRCm39) probably benign Het
Mms22l T C 4: 24,596,182 (GRCm39) L1047S probably damaging Het
Neb A G 2: 52,218,767 (GRCm39) I81T possibly damaging Het
Neurod4 A T 10: 130,106,958 (GRCm39) D105E probably damaging Het
Nlrp1b A G 11: 71,072,067 (GRCm39) L592P probably damaging Het
Nnt C A 13: 119,518,270 (GRCm39) K302N probably damaging Het
Notch4 T C 17: 34,806,364 (GRCm39) F1767S probably damaging Het
Or4c103 C A 2: 88,513,519 (GRCm39) A186S possibly damaging Het
Or7g16 T C 9: 18,727,138 (GRCm39) I151V probably benign Het
Pcdhga4 A T 18: 37,820,460 (GRCm39) I670F possibly damaging Het
Pdp1 T C 4: 11,962,143 (GRCm39) E75G possibly damaging Het
Pds5b T A 5: 150,724,249 (GRCm39) N1275K probably benign Het
Pink1 G T 4: 138,048,321 (GRCm39) Q134K probably benign Het
Poli T A 18: 70,642,250 (GRCm39) H650L probably damaging Het
Prickle2 G A 6: 92,388,505 (GRCm39) P355L possibly damaging Het
Prkaca G A 8: 84,717,305 (GRCm39) G194D probably benign Het
Ptgs2 A T 1: 149,980,175 (GRCm39) Y371F probably damaging Het
Rarb T A 14: 16,818,882 (GRCm38) probably benign Het
Rarb C T 14: 16,818,881 (GRCm38) probably benign Het
Safb2 ACTTCTTCT ACTTCT 17: 56,878,292 (GRCm39) probably benign Het
Serpinb1b T G 13: 33,269,393 (GRCm39) V42G probably damaging Het
Sgsm2 T A 11: 74,782,834 (GRCm39) I41F possibly damaging Het
Slc26a5 T A 5: 22,018,880 (GRCm39) D653V probably damaging Het
Slc26a7 C T 4: 14,506,630 (GRCm39) V602M possibly damaging Het
Slu7 T C 11: 43,334,224 (GRCm39) S417P probably damaging Het
Smad2 T A 18: 76,422,171 (GRCm39) D194E probably benign Het
Sntg1 A T 1: 8,748,056 (GRCm39) V112E probably damaging Het
Strip1 A T 3: 107,521,979 (GRCm39) M733K probably benign Het
Szt2 G A 4: 118,241,726 (GRCm39) S1655L possibly damaging Het
Ttn A T 2: 76,599,949 (GRCm39) I19075N probably benign Het
Urb2 C T 8: 124,771,890 (GRCm39) T1437I probably benign Het
Vmn2r111 T A 17: 22,790,822 (GRCm39) I159F probably benign Het
Zfp78 T C 7: 6,382,300 (GRCm39) V450A probably damaging Het
Zmynd11 T A 13: 9,743,475 (GRCm39) H314L probably benign Het
Other mutations in Or4c58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Or4c58 APN 2 89,674,439 (GRCm39) missense probably benign 0.00
IGL02184:Or4c58 APN 2 89,674,729 (GRCm39) missense probably damaging 0.98
IGL02408:Or4c58 APN 2 89,675,315 (GRCm39) start codon destroyed probably benign 0.04
IGL02437:Or4c58 APN 2 89,675,128 (GRCm39) missense probably damaging 0.98
IGL02985:Or4c58 APN 2 89,674,684 (GRCm39) missense possibly damaging 0.66
IGL03230:Or4c58 APN 2 89,674,457 (GRCm39) missense probably benign
IGL03393:Or4c58 APN 2 89,674,913 (GRCm39) missense probably benign 0.00
R0482:Or4c58 UTSW 2 89,674,513 (GRCm39) missense probably benign 0.20
R0555:Or4c58 UTSW 2 89,674,787 (GRCm39) missense probably benign 0.00
R1268:Or4c58 UTSW 2 89,674,498 (GRCm39) missense probably damaging 0.98
R1617:Or4c58 UTSW 2 89,674,598 (GRCm39) missense probably benign 0.03
R3552:Or4c58 UTSW 2 89,674,687 (GRCm39) missense possibly damaging 0.53
R4172:Or4c58 UTSW 2 89,675,122 (GRCm39) missense probably damaging 1.00
R4173:Or4c58 UTSW 2 89,675,122 (GRCm39) missense probably damaging 1.00
R4174:Or4c58 UTSW 2 89,675,122 (GRCm39) missense probably damaging 1.00
R5540:Or4c58 UTSW 2 89,675,011 (GRCm39) missense probably damaging 1.00
R5909:Or4c58 UTSW 2 89,674,735 (GRCm39) missense possibly damaging 0.89
R5941:Or4c58 UTSW 2 89,674,859 (GRCm39) missense probably benign 0.07
R7425:Or4c58 UTSW 2 89,674,789 (GRCm39) missense probably damaging 0.99
R7445:Or4c58 UTSW 2 89,674,616 (GRCm39) missense probably damaging 0.99
R7660:Or4c58 UTSW 2 89,674,787 (GRCm39) missense probably benign 0.00
R7978:Or4c58 UTSW 2 89,674,611 (GRCm39) nonsense probably null
R7996:Or4c58 UTSW 2 89,674,759 (GRCm39) missense probably benign 0.28
R8026:Or4c58 UTSW 2 89,675,273 (GRCm39) missense probably benign 0.06
R9420:Or4c58 UTSW 2 89,674,715 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCATCTATCAGCGACAGGAAAG -3'
(R):5'- ACAGGTTCCACTCCAGACTTC -3'

Sequencing Primer
(F):5'- CATCTATCAGCGACAGGAAAGAGAGG -3'
(R):5'- CCAGTTAGTGGTTTCCAAATGTGCC -3'
Posted On 2022-02-07