Mutagenetix > Incidental Mutation

Incidental Mutation 'R9184:Filip1'

697253

Institutional Source

Beutler Lab

Gene Symbol

Filip1

Ensembl Gene

ENSMUSG00000034898

Gene Name

filamin A interacting protein 1

Synonyms

5730485H21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

R9184 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79815051-80012851 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79898260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 71 (K71E)

Ref Sequence

ENSEMBL: ENSMUSP00000091329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973] [ENSMUST00000217264]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000093811
AA Change: K71E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: K71E

Domain	Start	End	E-Value	Type
Pfam:CortBP2	71	256	2.1e-64	PFAM
coiled coil region	258	540	N/A	INTRINSIC
low complexity region	545	564	N/A	INTRINSIC
low complexity region	579	592	N/A	INTRINSIC
coiled coil region	625	778	N/A	INTRINSIC
low complexity region	928	940	N/A	INTRINSIC
low complexity region	1126	1140	N/A	INTRINSIC
low complexity region	1168	1180	N/A	INTRINSIC
low complexity region	1198	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172973
AA Change: K71E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898
AA Change: K71E

Domain	Start	End	E-Value	Type
Pfam:CortBP2	65	225	5.2e-74	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217264

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,271,388	L692S	probably damaging	Het
6030452D12Rik	T	C	8: 106,507,269	V199A	unknown	Het
Abca7	A	G	10: 80,002,856	H621R	probably damaging	Het
Adam18	T	A	8: 24,647,831	N331I	probably benign	Het
Akt1	A	G	12: 112,654,718	S475P	possibly damaging	Het
Arc	A	G	15: 74,671,930	V148A	probably damaging	Het
Atg2a	T	C	19: 6,241,857	L21P	probably damaging	Het
C1qtnf2	T	C	11: 43,474,353	V25A	probably benign	Het
Cald1	G	T	6: 34,753,577	E244D	unknown	Het
Cdc42bpa	T	A	1: 180,144,736	F1368I	probably benign	Het
Cfap61	G	A	2: 146,077,388	C680Y	probably null	Het
Chd1	T	A	17: 15,742,289	N769K	possibly damaging	Het
Clasp1	T	A	1: 118,543,178	V848E	probably benign	Het
Col15a1	G	C	4: 47,288,200		probably benign	Het
Ctsb	G	T	14: 63,138,095	G170V	probably damaging	Het
Dnah5	A	G	15: 28,340,406	K2320E	probably benign	Het
Fat4	A	T	3: 38,982,443	I3415F	probably damaging	Het
Fibcd1	A	G	2: 31,816,476	S448P	probably damaging	Het
Gad2	G	A	2: 22,668,319	V350I	probably benign	Het
Gigyf2	T	A	1: 87,440,589	S1032T	possibly damaging	Het
Glis3	T	C	19: 28,531,607	T326A	probably damaging	Het
Hspa9	C	T	18: 34,949,115	R146H	possibly damaging	Het
Jakmip2	A	G	18: 43,582,287	I58T	probably benign	Het
Kcnk15	G	A	2: 163,858,686	V282M	probably benign	Het
Klk1b8	A	G	7: 43,952,734	N30S	probably benign	Het
Lpin2	T	A	17: 71,233,916	Y454*	probably null	Het
Mcam	T	C	9: 44,135,248		probably benign	Het
Mms22l	T	C	4: 24,596,182	L1047S	probably damaging	Het
Neb	A	G	2: 52,328,755	I81T	possibly damaging	Het
Neurod4	A	T	10: 130,271,089	D105E	probably damaging	Het
Nlrp1b	A	G	11: 71,181,241	L592P	probably damaging	Het
Nnt	C	A	13: 119,381,734	K302N	probably damaging	Het
Notch4	T	C	17: 34,587,390	F1767S	probably damaging	Het
Olfr1195	C	A	2: 88,683,175	A186S	possibly damaging	Het
Olfr48	T	A	2: 89,844,950	I8F	probably benign	Het
Olfr828	T	C	9: 18,815,842	I151V	probably benign	Het
Pcdhga4	A	T	18: 37,687,407	I670F	possibly damaging	Het
Pdp1	T	C	4: 11,962,143	E75G	possibly damaging	Het
Pds5b	T	A	5: 150,800,784	N1275K	probably benign	Het
Pink1	G	T	4: 138,321,010	Q134K	probably benign	Het
Poli	T	A	18: 70,509,179	H650L	probably damaging	Het
Prickle2	G	A	6: 92,411,524	P355L	possibly damaging	Het
Prkaca	G	A	8: 83,990,676	G194D	probably benign	Het
Ptgs2	A	T	1: 150,104,424	Y371F	probably damaging	Het
Rarb	C	T	14: 16,818,881		probably benign	Het
Rarb	T	A	14: 16,818,882		probably benign	Het
Safb2	ACTTCTTCT	ACTTCT	17: 56,571,292		probably benign	Het
Serpinb1b	T	G	13: 33,085,410	V42G	probably damaging	Het
Sgsm2	T	A	11: 74,892,008	I41F	possibly damaging	Het
Slc26a5	T	A	5: 21,813,882	D653V	probably damaging	Het
Slc26a7	C	T	4: 14,506,630	V602M	possibly damaging	Het
Slu7	T	C	11: 43,443,397	S417P	probably damaging	Het
Smad2	T	A	18: 76,289,100	D194E	probably benign	Het
Sntg1	A	T	1: 8,677,832	V112E	probably damaging	Het
Strip1	A	T	3: 107,614,663	M733K	probably benign	Het
Szt2	G	A	4: 118,384,529	S1655L	possibly damaging	Het
Ttn	A	T	2: 76,769,605	I19075N	probably benign	Het
Urb2	C	T	8: 124,045,151	T1437I	probably benign	Het
Vmn2r111	T	A	17: 22,571,841	I159F	probably benign	Het
Zfp78	T	C	7: 6,379,301	V450A	probably damaging	Het
Zmynd11	T	A	13: 9,693,439	H314L	probably benign	Het

Other mutations in Filip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Filip1	APN	9	79817944	missense	probably damaging	1.00
IGL01101:Filip1	APN	9	79898246	missense	probably benign	0.44
IGL01301:Filip1	APN	9	79819180	missense	possibly damaging	0.93
IGL01887:Filip1	APN	9	79819617	missense	probably benign	0.42
IGL02119:Filip1	APN	9	79818266	missense	probably benign
IGL02285:Filip1	APN	9	79820126	missense	probably damaging	1.00
IGL02395:Filip1	APN	9	79898410	missense	probably benign	0.01
IGL03398:Filip1	APN	9	79818943	missense	probably benign	0.03
IGL03400:Filip1	APN	9	79820473	missense	probably benign	0.01
IGL03404:Filip1	APN	9	79818559	missense	probably damaging	0.99
ANU18:Filip1	UTSW	9	79819180	missense	possibly damaging	0.93
BB010:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
BB020:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R0101:Filip1	UTSW	9	79819528	missense	probably benign	0.04
R0243:Filip1	UTSW	9	79819003	missense	probably damaging	0.98
R0244:Filip1	UTSW	9	79819462	missense	possibly damaging	0.87
R0371:Filip1	UTSW	9	79860091	missense	probably damaging	1.00
R0399:Filip1	UTSW	9	79818310	missense	possibly damaging	0.71
R0412:Filip1	UTSW	9	79820289	missense	possibly damaging	0.59
R0671:Filip1	UTSW	9	79819390	missense	probably damaging	1.00
R1314:Filip1	UTSW	9	79820566	missense	probably damaging	1.00
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1465:Filip1	UTSW	9	79898307	missense	probably benign	0.25
R1602:Filip1	UTSW	9	79820591	missense	probably damaging	0.99
R1801:Filip1	UTSW	9	79815846	missense	probably damaging	0.98
R1929:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R1983:Filip1	UTSW	9	79860092	missense	probably damaging	1.00
R2066:Filip1	UTSW	9	79820216	missense	probably damaging	1.00
R2128:Filip1	UTSW	9	79819330	missense	probably damaging	0.99
R2271:Filip1	UTSW	9	79819930	missense	probably damaging	1.00
R2411:Filip1	UTSW	9	79898433	missense	probably damaging	0.98
R3429:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3430:Filip1	UTSW	9	79853670	missense	probably damaging	1.00
R3945:Filip1	UTSW	9	79818367	missense	probably benign	0.01
R4007:Filip1	UTSW	9	79818727	missense	possibly damaging	0.71
R4583:Filip1	UTSW	9	79815809	missense	possibly damaging	0.76
R4803:Filip1	UTSW	9	79820114	missense	probably benign	0.05
R4837:Filip1	UTSW	9	79819459	missense	probably damaging	0.98
R4910:Filip1	UTSW	9	79817932	missense	probably benign	0.00
R4929:Filip1	UTSW	9	79819747	missense	probably benign	0.07
R5387:Filip1	UTSW	9	79818274	missense	probably benign
R5581:Filip1	UTSW	9	79819760	missense	possibly damaging	0.95
R5808:Filip1	UTSW	9	79818701	missense	possibly damaging	0.67
R5891:Filip1	UTSW	9	79819860	missense	possibly damaging	0.69
R6166:Filip1	UTSW	9	79819454	missense	probably damaging	0.99
R6273:Filip1	UTSW	9	79815886	missense	probably benign	0.01
R6380:Filip1	UTSW	9	79819624	missense	probably damaging	0.99
R6385:Filip1	UTSW	9	79820531	missense	possibly damaging	0.68
R6614:Filip1	UTSW	9	79815839	missense	probably damaging	1.00
R6715:Filip1	UTSW	9	79818758	missense	probably benign	0.03
R7047:Filip1	UTSW	9	79853634	missense	probably damaging	0.98
R7126:Filip1	UTSW	9	79898295	missense	possibly damaging	0.88
R7144:Filip1	UTSW	9	79820213	missense	possibly damaging	0.65
R7218:Filip1	UTSW	9	79818074	missense	probably benign
R7404:Filip1	UTSW	9	79820098	missense	possibly damaging	0.94
R7702:Filip1	UTSW	9	79820649	missense	probably benign	0.20
R7866:Filip1	UTSW	9	79818943	missense	probably benign	0.03
R7933:Filip1	UTSW	9	79820047	missense	possibly damaging	0.65
R8012:Filip1	UTSW	9	79817959	missense	probably damaging	0.97
R8097:Filip1	UTSW	9	79818259	missense	probably benign
R8213:Filip1	UTSW	9	79818092	missense	probably benign	0.01
R8305:Filip1	UTSW	9	79820475	nonsense	probably null
R8798:Filip1	UTSW	9	79820090	missense	possibly damaging	0.94
R9322:Filip1	UTSW	9	79819732	missense	probably benign	0.01
R9334:Filip1	UTSW	9	79818457	missense	probably benign	0.32
R9353:Filip1	UTSW	9	79818341	missense	possibly damaging	0.67
R9541:Filip1	UTSW	9	79819853	nonsense	probably null
R9607:Filip1	UTSW	9	79819120	missense	probably damaging	1.00
X0054:Filip1	UTSW	9	79819535	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAACTGAGGATGGTAAGCCCC -3'
(R):5'- TTGCAGGTGGGAATGAGATC -3'

Sequencing Primer
(F):5'- AGGATGGTAAGCCCCCTTCC -3'
(R):5'- AAGTTCATCTAATGGGCATGTCTCC -3'

Posted On

2022-02-07