Incidental Mutation 'R9184:Hspa9'
ID 697275
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Name heat shock protein 9
Synonyms C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock # R9184 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34937414-34954357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34949115 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 146 (R146H)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
AlphaFold P38647
Predicted Effect possibly damaging
Transcript: ENSMUST00000025217
AA Change: R146H

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: R146H

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,271,388 L692S probably damaging Het
6030452D12Rik T C 8: 106,507,269 V199A unknown Het
Abca7 A G 10: 80,002,856 H621R probably damaging Het
Adam18 T A 8: 24,647,831 N331I probably benign Het
Akt1 A G 12: 112,654,718 S475P possibly damaging Het
Arc A G 15: 74,671,930 V148A probably damaging Het
Atg2a T C 19: 6,241,857 L21P probably damaging Het
C1qtnf2 T C 11: 43,474,353 V25A probably benign Het
Cald1 G T 6: 34,753,577 E244D unknown Het
Cdc42bpa T A 1: 180,144,736 F1368I probably benign Het
Cfap61 G A 2: 146,077,388 C680Y probably null Het
Chd1 T A 17: 15,742,289 N769K possibly damaging Het
Clasp1 T A 1: 118,543,178 V848E probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Ctsb G T 14: 63,138,095 G170V probably damaging Het
Dnah5 A G 15: 28,340,406 K2320E probably benign Het
Fat4 A T 3: 38,982,443 I3415F probably damaging Het
Fibcd1 A G 2: 31,816,476 S448P probably damaging Het
Filip1 T C 9: 79,898,260 K71E probably benign Het
Gad2 G A 2: 22,668,319 V350I probably benign Het
Gigyf2 T A 1: 87,440,589 S1032T possibly damaging Het
Glis3 T C 19: 28,531,607 T326A probably damaging Het
Jakmip2 A G 18: 43,582,287 I58T probably benign Het
Kcnk15 G A 2: 163,858,686 V282M probably benign Het
Klk1b8 A G 7: 43,952,734 N30S probably benign Het
Lpin2 T A 17: 71,233,916 Y454* probably null Het
Mms22l T C 4: 24,596,182 L1047S probably damaging Het
Neb A G 2: 52,328,755 I81T possibly damaging Het
Neurod4 A T 10: 130,271,089 D105E probably damaging Het
Nlrp1b A G 11: 71,181,241 L592P probably damaging Het
Nnt C A 13: 119,381,734 K302N probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr1195 C A 2: 88,683,175 A186S possibly damaging Het
Olfr48 T A 2: 89,844,950 I8F probably benign Het
Olfr828 T C 9: 18,815,842 I151V probably benign Het
Pcdhga4 A T 18: 37,687,407 I670F possibly damaging Het
Pdp1 T C 4: 11,962,143 E75G possibly damaging Het
Pds5b T A 5: 150,800,784 N1275K probably benign Het
Pink1 G T 4: 138,321,010 Q134K probably benign Het
Poli T A 18: 70,509,179 H650L probably damaging Het
Prickle2 G A 6: 92,411,524 P355L possibly damaging Het
Prkaca G A 8: 83,990,676 G194D probably benign Het
Ptgs2 A T 1: 150,104,424 Y371F probably damaging Het
Rarb C T 14: 16,818,881 probably benign Het
Rarb T A 14: 16,818,882 probably benign Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Serpinb1b T G 13: 33,085,410 V42G probably damaging Het
Sgsm2 T A 11: 74,892,008 I41F possibly damaging Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Slc26a7 C T 4: 14,506,630 V602M possibly damaging Het
Slu7 T C 11: 43,443,397 S417P probably damaging Het
Smad2 T A 18: 76,289,100 D194E probably benign Het
Sntg1 A T 1: 8,677,832 V112E probably damaging Het
Strip1 A T 3: 107,614,663 M733K probably benign Het
Szt2 G A 4: 118,384,529 S1655L possibly damaging Het
Ttn A T 2: 76,769,605 I19075N probably benign Het
Urb2 C T 8: 124,045,151 T1437I probably benign Het
Vmn2r111 T A 17: 22,571,841 I159F probably benign Het
Zfp78 T C 7: 6,379,301 V450A probably damaging Het
Zmynd11 T A 13: 9,693,439 H314L probably benign Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1414:Hspa9 UTSW 18 34938591 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7404:Hspa9 UTSW 18 34943276 missense possibly damaging 0.76
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R8524:Hspa9 UTSW 18 34954244 missense unknown
R8830:Hspa9 UTSW 18 34948104 critical splice donor site probably null
R8987:Hspa9 UTSW 18 34947929 missense probably damaging 1.00
R9028:Hspa9 UTSW 18 34942031 missense probably damaging 1.00
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACCCAATCTGCAGGTTCTACC -3'
(R):5'- AAGTCAGTGTTCAACTTCTTCCTTG -3'

Sequencing Primer
(F):5'- AGCTTCAGACTCCATTATCTACAG -3'
(R):5'- TGCATCTGTACTTATTTTTGTGACC -3'
Posted On 2022-02-07