Incidental Mutation 'R9184:Jakmip2'
ID 697277
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R9184 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43582287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: I58T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: I58T

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,271,388 L692S probably damaging Het
6030452D12Rik T C 8: 106,507,269 V199A unknown Het
Abca7 A G 10: 80,002,856 H621R probably damaging Het
Adam18 T A 8: 24,647,831 N331I probably benign Het
Akt1 A G 12: 112,654,718 S475P possibly damaging Het
Arc A G 15: 74,671,930 V148A probably damaging Het
Atg2a T C 19: 6,241,857 L21P probably damaging Het
C1qtnf2 T C 11: 43,474,353 V25A probably benign Het
Cald1 G T 6: 34,753,577 E244D unknown Het
Cdc42bpa T A 1: 180,144,736 F1368I probably benign Het
Cfap61 G A 2: 146,077,388 C680Y probably null Het
Chd1 T A 17: 15,742,289 N769K possibly damaging Het
Clasp1 T A 1: 118,543,178 V848E probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Ctsb G T 14: 63,138,095 G170V probably damaging Het
Dnah5 A G 15: 28,340,406 K2320E probably benign Het
Fat4 A T 3: 38,982,443 I3415F probably damaging Het
Fibcd1 A G 2: 31,816,476 S448P probably damaging Het
Filip1 T C 9: 79,898,260 K71E probably benign Het
Gad2 G A 2: 22,668,319 V350I probably benign Het
Gigyf2 T A 1: 87,440,589 S1032T possibly damaging Het
Glis3 T C 19: 28,531,607 T326A probably damaging Het
Hspa9 C T 18: 34,949,115 R146H possibly damaging Het
Kcnk15 G A 2: 163,858,686 V282M probably benign Het
Klk1b8 A G 7: 43,952,734 N30S probably benign Het
Lpin2 T A 17: 71,233,916 Y454* probably null Het
Mcam T C 9: 44,135,248 probably benign Het
Mms22l T C 4: 24,596,182 L1047S probably damaging Het
Neb A G 2: 52,328,755 I81T possibly damaging Het
Neurod4 A T 10: 130,271,089 D105E probably damaging Het
Nlrp1b A G 11: 71,181,241 L592P probably damaging Het
Nnt C A 13: 119,381,734 K302N probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr1195 C A 2: 88,683,175 A186S possibly damaging Het
Olfr48 T A 2: 89,844,950 I8F probably benign Het
Olfr828 T C 9: 18,815,842 I151V probably benign Het
Pcdhga4 A T 18: 37,687,407 I670F possibly damaging Het
Pdp1 T C 4: 11,962,143 E75G possibly damaging Het
Pds5b T A 5: 150,800,784 N1275K probably benign Het
Pink1 G T 4: 138,321,010 Q134K probably benign Het
Poli T A 18: 70,509,179 H650L probably damaging Het
Prickle2 G A 6: 92,411,524 P355L possibly damaging Het
Prkaca G A 8: 83,990,676 G194D probably benign Het
Ptgs2 A T 1: 150,104,424 Y371F probably damaging Het
Rarb C T 14: 16,818,881 probably benign Het
Rarb T A 14: 16,818,882 probably benign Het
Safb2 ACTTCTTCT ACTTCT 17: 56,571,292 probably benign Het
Serpinb1b T G 13: 33,085,410 V42G probably damaging Het
Sgsm2 T A 11: 74,892,008 I41F possibly damaging Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Slc26a7 C T 4: 14,506,630 V602M possibly damaging Het
Slu7 T C 11: 43,443,397 S417P probably damaging Het
Smad2 T A 18: 76,289,100 D194E probably benign Het
Sntg1 A T 1: 8,677,832 V112E probably damaging Het
Strip1 A T 3: 107,614,663 M733K probably benign Het
Szt2 G A 4: 118,384,529 S1655L possibly damaging Het
Ttn A T 2: 76,769,605 I19075N probably benign Het
Urb2 C T 8: 124,045,151 T1437I probably benign Het
Vmn2r111 T A 17: 22,571,841 I159F probably benign Het
Zfp78 T C 7: 6,379,301 V450A probably damaging Het
Zmynd11 T A 13: 9,693,439 H314L probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GACTTGAGTCTCTGAATCTCCC -3'
(R):5'- GCTTTAAGGCCCTGGCTTTC -3'

Sequencing Primer
(F):5'- GAGTCTCTGAATCTCCCCATCC -3'
(R):5'- CGGGAGTAAGCGTTTTCT -3'
Posted On 2022-02-07