Incidental Mutation 'R9185:Plxnd1'
ID 697303
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9185 (G1)
Quality Score 147.008
Status Not validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115957565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1802 (F1802L)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: F1802L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: F1802L

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 A G 7: 119,578,198 H312R possibly damaging Het
Aloxe3 T C 11: 69,134,288 F409S probably damaging Het
Arfgef1 T A 1: 10,144,779 N1630I probably damaging Het
Catsperd G A 17: 56,661,252 D546N probably benign Het
Cbl A G 9: 44,152,840 S800P probably damaging Het
Ccne1 A T 7: 38,099,830 S220T probably benign Het
Cd177 T C 7: 24,744,243 Y810C probably benign Het
Cercam T C 2: 29,876,021 V304A possibly damaging Het
Cfap100 T C 6: 90,413,434 T75A Het
Clcn4 T A 7: 7,284,198 I744F possibly damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col27a1 A G 4: 63,328,650 N1670S unknown Het
Cps1 G A 1: 67,209,672 R1186Q probably benign Het
Cr1l C A 1: 195,114,745 C328F probably damaging Het
Crybg1 T A 10: 44,004,095 T366S probably benign Het
Ctbp2 A T 7: 133,013,983 S408T probably damaging Het
Dync1h1 T C 12: 110,635,503 S1992P probably benign Het
Glyatl3 A T 17: 40,914,343 V3E probably damaging Het
Gm13088 T C 4: 143,655,328 N266S probably benign Het
Gse1 T C 8: 120,568,169 M343T possibly damaging Het
Gys2 T C 6: 142,459,386 D225G probably damaging Het
Hecw1 T C 13: 14,317,043 S42G probably damaging Het
Helz2 A G 2: 181,230,090 C2673R probably benign Het
Hivep1 G A 13: 42,184,499 V2685I possibly damaging Het
Icam5 A G 9: 21,038,869 E908G probably damaging Het
Kcne1 A T 16: 92,348,908 L16Q possibly damaging Het
Kcnk5 G T 14: 20,145,067 Y118* probably null Het
Kctd11 T C 11: 69,879,850 T121A possibly damaging Het
Mier3 T C 13: 111,714,726 V414A probably benign Het
Mindy4 T C 6: 55,318,276 S734P possibly damaging Het
Mrps26 T C 2: 130,563,849 V24A probably benign Het
Mug2 C G 6: 122,077,483 Q1074E probably benign Het
Myo15b T C 11: 115,880,429 S1P unknown Het
Ninj1 A T 13: 49,191,250 T81S probably benign Het
Nod2 A T 8: 88,665,252 H729L probably damaging Het
Olfm5 G A 7: 104,160,888 Q89* probably null Het
Olfr1109 A C 2: 87,092,856 D180E possibly damaging Het
Olfr1113 A T 2: 87,213,830 T313S probably benign Het
Olfr133 A T 17: 38,148,863 I92F probably damaging Het
Olfr1382 T C 11: 49,535,674 V163A probably benign Het
Olfr1489 A T 19: 13,633,401 T97S probably benign Het
Olfr1508 A G 14: 52,463,527 S161P probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr968 T A 9: 39,772,108 T231S probably benign Het
Pde4dip T A 3: 97,758,816 T371S probably benign Het
Pkhd1l1 T A 15: 44,589,623 S3981R probably benign Het
Prcp A G 7: 92,933,049 H449R probably benign Het
Prrc2c A G 1: 162,704,643 W1468R unknown Het
Rcvrn A G 11: 67,695,654 T80A possibly damaging Het
Rhou T C 8: 123,661,054 L175P probably damaging Het
Sacs T C 14: 61,206,666 S2054P probably damaging Het
Slc22a30 A G 19: 8,344,553 S414P probably benign Het
Slc2a13 T A 15: 91,343,703 S429C probably damaging Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smyd3 A G 1: 179,050,289 probably null Het
Strip1 T A 3: 107,628,214 E64D probably damaging Het
Sumf2 T G 5: 129,847,068 C25G possibly damaging Het
Syngap1 A C 17: 26,963,083 D1190A possibly damaging Het
Tas2r139 C T 6: 42,141,165 T77I probably benign Het
Tbce A T 13: 13,998,442 V468D probably damaging Het
Tmem191c G A 16: 17,276,438 R42H probably damaging Het
Tmem200c T C 17: 68,840,638 V72A probably damaging Het
Ttc28 T G 5: 111,223,476 F628C probably benign Het
Wsb2 G A 5: 117,363,671 V34M possibly damaging Het
Zfand6 A G 7: 84,634,350 S15P probably damaging Het
Zfp964 A G 8: 69,663,223 N158D possibly damaging Het
Zic1 G T 9: 91,364,489 Q177K probably benign Het
Zswim4 T C 8: 84,237,004 M1V probably null Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense not run
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTCTTCTCAGAAGGCCTTTATGG -3'
(R):5'- GACCAGCATTGTCTACCTCC -3'

Sequencing Primer
(F):5'- ACTGAACCGGCATATCCTCTG -3'
(R):5'- AGCATTGTCTACCTCCCCAGC -3'
Posted On 2022-02-07