Mutagenetix > Incidental Mutation

Incidental Mutation 'R9185:Plxnd1'

697303

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9185 (G1)

Quality Score

147.008

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 115957565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1802 (F1802L)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: F1802L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: F1802L

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Meta Mutation Damage Score

0.7905

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	A	G	7: 119,578,198	H312R	possibly damaging	Het
Aloxe3	T	C	11: 69,134,288	F409S	probably damaging	Het
Arfgef1	T	A	1: 10,144,779	N1630I	probably damaging	Het
Catsperd	G	A	17: 56,661,252	D546N	probably benign	Het
Cbl	A	G	9: 44,152,840	S800P	probably damaging	Het
Ccne1	A	T	7: 38,099,830	S220T	probably benign	Het
Cd177	T	C	7: 24,744,243	Y810C	probably benign	Het
Cercam	T	C	2: 29,876,021	V304A	possibly damaging	Het
Cfap100	T	C	6: 90,413,434	T75A		Het
Clcn4	T	A	7: 7,284,198	I744F	possibly damaging	Het
Col15a1	G	C	4: 47,288,200		probably benign	Het
Col27a1	A	G	4: 63,328,650	N1670S	unknown	Het
Cps1	G	A	1: 67,209,672	R1186Q	probably benign	Het
Cr1l	C	A	1: 195,114,745	C328F	probably damaging	Het
Crybg1	T	A	10: 44,004,095	T366S	probably benign	Het
Ctbp2	A	T	7: 133,013,983	S408T	probably damaging	Het
Dync1h1	T	C	12: 110,635,503	S1992P	probably benign	Het
Glyatl3	A	T	17: 40,914,343	V3E	probably damaging	Het
Gm13088	T	C	4: 143,655,328	N266S	probably benign	Het
Gse1	T	C	8: 120,568,169	M343T	possibly damaging	Het
Gys2	T	C	6: 142,459,386	D225G	probably damaging	Het
Hecw1	T	C	13: 14,317,043	S42G	probably damaging	Het
Helz2	A	G	2: 181,230,090	C2673R	probably benign	Het
Hivep1	G	A	13: 42,184,499	V2685I	possibly damaging	Het
Icam5	A	G	9: 21,038,869	E908G	probably damaging	Het
Kcne1	A	T	16: 92,348,908	L16Q	possibly damaging	Het
Kcnk5	G	T	14: 20,145,067	Y118*	probably null	Het
Kctd11	T	C	11: 69,879,850	T121A	possibly damaging	Het
Mier3	T	C	13: 111,714,726	V414A	probably benign	Het
Mindy4	T	C	6: 55,318,276	S734P	possibly damaging	Het
Mrps26	T	C	2: 130,563,849	V24A	probably benign	Het
Mug2	C	G	6: 122,077,483	Q1074E	probably benign	Het
Myo15b	T	C	11: 115,880,429	S1P	unknown	Het
Ninj1	A	T	13: 49,191,250	T81S	probably benign	Het
Nod2	A	T	8: 88,665,252	H729L	probably damaging	Het
Nr1i3	G	A	1: 171,216,386	V49I	possibly damaging	Het
Olfm5	G	A	7: 104,160,888	Q89*	probably null	Het
Olfr1109	A	C	2: 87,092,856	D180E	possibly damaging	Het
Olfr1113	A	T	2: 87,213,830	T313S	probably benign	Het
Olfr133	A	T	17: 38,148,863	I92F	probably damaging	Het
Olfr1382	T	C	11: 49,535,674	V163A	probably benign	Het
Olfr1489	A	T	19: 13,633,401	T97S	probably benign	Het
Olfr1508	A	G	14: 52,463,527	S161P	probably benign	Het
Olfr559	C	T	7: 102,724,202	R96H	possibly damaging	Het
Olfr968	T	A	9: 39,772,108	T231S	probably benign	Het
Pde4dip	T	A	3: 97,758,816	T371S	probably benign	Het
Pkhd1l1	T	A	15: 44,589,623	S3981R	probably benign	Het
Prcp	A	G	7: 92,933,049	H449R	probably benign	Het
Prrc2c	A	G	1: 162,704,643	W1468R	unknown	Het
Rcvrn	A	G	11: 67,695,654	T80A	possibly damaging	Het
Rhou	T	C	8: 123,661,054	L175P	probably damaging	Het
Sacs	T	C	14: 61,206,666	S2054P	probably damaging	Het
Slc22a30	A	G	19: 8,344,553	S414P	probably benign	Het
Slc2a13	T	A	15: 91,343,703	S429C	probably damaging	Het
Slc35b3	A	G	13: 38,939,982		probably benign	Het
Smyd3	A	G	1: 179,050,289		probably null	Het
Strip1	T	A	3: 107,628,214	E64D	probably damaging	Het
Sumf2	T	G	5: 129,847,068	C25G	possibly damaging	Het
Syngap1	A	C	17: 26,963,083	D1190A	possibly damaging	Het
Tas2r139	C	T	6: 42,141,165	T77I	probably benign	Het
Tbce	A	T	13: 13,998,442	V468D	probably damaging	Het
Tmem191c	G	A	16: 17,276,438	R42H	probably damaging	Het
Tmem200c	T	C	17: 68,840,638	V72A	probably damaging	Het
Ttc28	T	G	5: 111,223,476	F628C	probably benign	Het
Wsb2	G	A	5: 117,363,671	V34M	possibly damaging	Het
Zfand6	A	G	7: 84,634,350	S15P	probably damaging	Het
Zfp964	A	G	8: 69,663,223	N158D	possibly damaging	Het
Zic1	G	T	9: 91,364,489	Q177K	probably benign	Het
Zswim4	T	C	8: 84,237,004	M1V	probably null	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCTCTTCTCAGAAGGCCTTTATGG -3'
(R):5'- GACCAGCATTGTCTACCTCC -3'

Sequencing Primer
(F):5'- ACTGAACCGGCATATCCTCTG -3'
(R):5'- AGCATTGTCTACCTCCCCAGC -3'

Posted On

2022-02-07