Mutagenetix > Incidental Mutation

Incidental Mutation 'R9186:Szt2'

697362

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.591) question?

Stock #

R9186 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118385091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1565 (F1565S)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075406
AA Change: F1565S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: F1565S

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	C	A	9: 57,257,189	R634L	probably damaging	Het
Ankhd1	T	C	18: 36,634,330	I210T	possibly damaging	Het
Ankle2	G	A	5: 110,252,744	V649M	possibly damaging	Het
Arid3b	A	T	9: 57,794,934		probably null	Het
Arl10	A	G	13: 54,578,807	N133D	probably damaging	Het
Bag6	C	T	17: 35,144,691	R784W	probably damaging	Het
Ccnl1	T	C	3: 65,958,005	T42A	unknown	Het
Cd164	C	A	10: 41,528,699	P151Q	probably damaging	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Ceacam2	T	A	7: 25,527,788	N218I	probably damaging	Het
Cfap97	C	T	8: 46,191,628	R466C	possibly damaging	Het
Colgalt2	C	A	1: 152,508,652	T581K	probably damaging	Het
Dnah11	T	A	12: 118,190,897	D216V	probably benign	Het
Dusp13	A	T	14: 21,748,495	S34T	probably damaging	Het
Esf1	T	A	2: 140,148,872	K564I	possibly damaging	Het
F5	A	G	1: 164,193,901	N1315S	probably benign	Het
Fubp1	A	T	3: 152,220,516	M292L	probably damaging	Het
Gabrb2	A	T	11: 42,487,373	M139L	possibly damaging	Het
Gk5	T	A	9: 96,133,416	V95D	probably benign	Het
Glcci1	C	A	6: 8,537,826	P148Q	possibly damaging	Het
Gm19410	A	T	8: 35,815,475	S1952C	possibly damaging	Het
Gstm4	T	C	3: 108,044,733		probably benign	Het
Heatr1	T	A	13: 12,421,346	L1211Q	probably damaging	Het
Helz2	A	G	2: 181,234,664	S1346P	possibly damaging	Het
Hexb	A	C	13: 97,189,328	V158G	probably damaging	Het
Hipk3	T	C	2: 104,471,094	E251G	probably damaging	Het
Hps5	T	C	7: 46,788,946	Y89C	probably damaging	Het
Iqub	A	T	6: 24,450,767	V611D	possibly damaging	Het
Itgbl1	G	A	14: 123,857,558	D332N	probably benign	Het
Krtap26-1	C	A	16: 88,647,721	R4L	unknown	Het
Lgi3	A	G	14: 70,534,753	Y246C	probably damaging	Het
Mug2	T	A	6: 122,075,289	I1002N	probably damaging	Het
Myo18a	C	T	11: 77,859,021	T66M		Het
Naip6	T	C	13: 100,299,882	D711G	possibly damaging	Het
Olfr1312	C	A	2: 112,042,750	C94F	probably damaging	Het
Orc5	T	A	5: 22,547,946	Q48L	probably benign	Het
Oxct2a	C	A	4: 123,322,668	A307S	probably damaging	Het
Pgls	T	C	8: 71,596,189	*258Q	probably null	Het
Plekha6	C	T	1: 133,292,433	R955W	probably damaging	Het
Polr1c	G	T	17: 46,245,707	N97K	probably damaging	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
Prtg	T	C	9: 72,856,877	V544A	probably benign	Het
Rbl2	G	A	8: 91,101,378	G574S	probably damaging	Het
Scamp1	T	A	13: 94,208,174	T272S	possibly damaging	Het
Sun2	T	A	15: 79,727,536	D562V	probably damaging	Het
Tatdn2	C	T	6: 113,710,164	R779C	probably benign	Het
Tbc1d30	T	C	10: 121,275,734	I430V	probably benign	Het
Tmem86b	T	C	7: 4,629,726	D43G	probably damaging	Het
Tnrc18	T	C	5: 142,787,733	N447S		Het
Trmt2a	T	C	16: 18,251,169	S292P	probably benign	Het
Trpc2	T	C	7: 102,088,285	V428A	probably damaging	Het
Tsc2	T	C	17: 24,604,888	E981G	probably damaging	Het
Ucp1	G	T	8: 83,290,643	G21*	probably null	Het
Utrn	T	C	10: 12,614,574	T21A	probably benign	Het
Vapa	A	T	17: 65,593,512	N88K	probably damaging	Het
Wasl	T	C	6: 24,664,616	R10G	probably damaging	Het
Zan	C	A	5: 137,393,548	V4662F	unknown	Het
Zap70	G	A	1: 36,779,751	M382I	possibly damaging	Het
Zdhhc17	T	C	10: 110,944,420	I624M	probably benign	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCCAAGTTCTAGATGGTACC -3'
(R):5'- GTGTGGTCACTGAAAGCGATC -3'

Sequencing Primer
(F):5'- GATGGTACCAAGTCATTCTCCTAGAC -3'
(R):5'- TCACTGAAAGCGATCCAGAGCTG -3'

Posted On

2022-02-07