Incidental Mutation 'R9186:Mug2'
ID 697373
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122052248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1002 (I1002N)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: I1002N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: I1002N

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,164,472 (GRCm39) R634L probably damaging Het
Ankhd1 T C 18: 36,767,383 (GRCm39) I210T possibly damaging Het
Ankle2 G A 5: 110,400,610 (GRCm39) V649M possibly damaging Het
Arid3b A T 9: 57,702,217 (GRCm39) probably null Het
Arl10 A G 13: 54,726,620 (GRCm39) N133D probably damaging Het
Bag6 C T 17: 35,363,667 (GRCm39) R784W probably damaging Het
Ccnl1 T C 3: 65,865,426 (GRCm39) T42A unknown Het
Cd164 C A 10: 41,404,695 (GRCm39) P151Q probably damaging Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Ceacam2 T A 7: 25,227,213 (GRCm39) N218I probably damaging Het
Cfap97 C T 8: 46,644,665 (GRCm39) R466C possibly damaging Het
Colgalt2 C A 1: 152,384,403 (GRCm39) T581K probably damaging Het
Dnah11 T A 12: 118,154,632 (GRCm39) D216V probably benign Het
Dusp13b A T 14: 21,798,563 (GRCm39) S34T probably damaging Het
Esf1 T A 2: 139,990,792 (GRCm39) K564I possibly damaging Het
F5 A G 1: 164,021,470 (GRCm39) N1315S probably benign Het
Fubp1 A T 3: 151,926,153 (GRCm39) M292L probably damaging Het
Gabrb2 A T 11: 42,378,200 (GRCm39) M139L possibly damaging Het
Gk5 T A 9: 96,015,469 (GRCm39) V95D probably benign Het
Glcci1 C A 6: 8,537,826 (GRCm39) P148Q possibly damaging Het
Gm19410 A T 8: 36,282,629 (GRCm39) S1952C possibly damaging Het
Gstm4 T C 3: 107,952,049 (GRCm39) probably benign Het
Heatr1 T A 13: 12,436,227 (GRCm39) L1211Q probably damaging Het
Helz2 A G 2: 180,876,457 (GRCm39) S1346P possibly damaging Het
Hexb A C 13: 97,325,836 (GRCm39) V158G probably damaging Het
Hipk3 T C 2: 104,301,439 (GRCm39) E251G probably damaging Het
Hps5 T C 7: 46,438,370 (GRCm39) Y89C probably damaging Het
Iqub A T 6: 24,450,766 (GRCm39) V611D possibly damaging Het
Itgbl1 G A 14: 124,094,970 (GRCm39) D332N probably benign Het
Krtap26-1 C A 16: 88,444,609 (GRCm39) R4L unknown Het
Lgi3 A G 14: 70,772,193 (GRCm39) Y246C probably damaging Het
Myo18a C T 11: 77,749,847 (GRCm39) T66M Het
Naip6 T C 13: 100,436,390 (GRCm39) D711G possibly damaging Het
Or4f59 C A 2: 111,873,095 (GRCm39) C94F probably damaging Het
Orc5 T A 5: 22,752,944 (GRCm39) Q48L probably benign Het
Oxct2a C A 4: 123,216,461 (GRCm39) A307S probably damaging Het
Pgls T C 8: 72,048,833 (GRCm39) *258Q probably null Het
Plekha6 C T 1: 133,220,171 (GRCm39) R955W probably damaging Het
Polr1c G T 17: 46,556,633 (GRCm39) N97K probably damaging Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prtg T C 9: 72,764,159 (GRCm39) V544A probably benign Het
Rbl2 G A 8: 91,828,006 (GRCm39) G574S probably damaging Het
Scamp1 T A 13: 94,344,682 (GRCm39) T272S possibly damaging Het
Sun2 T A 15: 79,611,737 (GRCm39) D562V probably damaging Het
Szt2 A G 4: 118,242,288 (GRCm39) F1565S probably damaging Het
Tatdn2 C T 6: 113,687,125 (GRCm39) R779C probably benign Het
Tbc1d30 T C 10: 121,111,639 (GRCm39) I430V probably benign Het
Tmem86b T C 7: 4,632,725 (GRCm39) D43G probably damaging Het
Tnrc18 T C 5: 142,773,488 (GRCm39) N447S Het
Trmt2a T C 16: 18,069,033 (GRCm39) S292P probably benign Het
Trpc2 T C 7: 101,737,492 (GRCm39) V428A probably damaging Het
Tsc2 T C 17: 24,823,862 (GRCm39) E981G probably damaging Het
Ucp1 G T 8: 84,017,272 (GRCm39) G21* probably null Het
Utrn T C 10: 12,490,318 (GRCm39) T21A probably benign Het
Vapa A T 17: 65,900,507 (GRCm39) N88K probably damaging Het
Wasl T C 6: 24,664,615 (GRCm39) R10G probably damaging Het
Zan C A 5: 137,391,810 (GRCm39) V4662F unknown Het
Zap70 G A 1: 36,818,832 (GRCm39) M382I possibly damaging Het
Zdhhc17 T C 10: 110,780,281 (GRCm39) I624M probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCCATTCTGATGTAATTCCTC -3'
(R):5'- ACCTGGAATAGAAGGCTTTGGG -3'

Sequencing Primer
(F):5'- CTCACTTCCAGGTGATATCTTGAG -3'
(R):5'- TGGCAGACTGTAAATCTGAAGGC -3'
Posted On 2022-02-07