Incidental Mutation 'R9186:Mug2'
ID 697373
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122075289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1002 (I1002N)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: I1002N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: I1002N

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,257,189 R634L probably damaging Het
Ankhd1 T C 18: 36,634,330 I210T possibly damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arid3b A T 9: 57,794,934 probably null Het
Arl10 A G 13: 54,578,807 N133D probably damaging Het
Bag6 C T 17: 35,144,691 R784W probably damaging Het
Ccnl1 T C 3: 65,958,005 T42A unknown Het
Cd164 C A 10: 41,528,699 P151Q probably damaging Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Ceacam2 T A 7: 25,527,788 N218I probably damaging Het
Cfap97 C T 8: 46,191,628 R466C possibly damaging Het
Colgalt2 C A 1: 152,508,652 T581K probably damaging Het
Dnah11 T A 12: 118,190,897 D216V probably benign Het
Dusp13 A T 14: 21,748,495 S34T probably damaging Het
Esf1 T A 2: 140,148,872 K564I possibly damaging Het
F5 A G 1: 164,193,901 N1315S probably benign Het
Fubp1 A T 3: 152,220,516 M292L probably damaging Het
Gabrb2 A T 11: 42,487,373 M139L possibly damaging Het
Gk5 T A 9: 96,133,416 V95D probably benign Het
Glcci1 C A 6: 8,537,826 P148Q possibly damaging Het
Gm19410 A T 8: 35,815,475 S1952C possibly damaging Het
Gstm4 T C 3: 108,044,733 probably benign Het
Heatr1 T A 13: 12,421,346 L1211Q probably damaging Het
Helz2 A G 2: 181,234,664 S1346P possibly damaging Het
Hexb A C 13: 97,189,328 V158G probably damaging Het
Hipk3 T C 2: 104,471,094 E251G probably damaging Het
Hps5 T C 7: 46,788,946 Y89C probably damaging Het
Iqub A T 6: 24,450,767 V611D possibly damaging Het
Itgbl1 G A 14: 123,857,558 D332N probably benign Het
Krtap26-1 C A 16: 88,647,721 R4L unknown Het
Lgi3 A G 14: 70,534,753 Y246C probably damaging Het
Myo18a C T 11: 77,859,021 T66M Het
Naip6 T C 13: 100,299,882 D711G possibly damaging Het
Olfr1312 C A 2: 112,042,750 C94F probably damaging Het
Orc5 T A 5: 22,547,946 Q48L probably benign Het
Oxct2a C A 4: 123,322,668 A307S probably damaging Het
Pgls T C 8: 71,596,189 *258Q probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Polr1c G T 17: 46,245,707 N97K probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prtg T C 9: 72,856,877 V544A probably benign Het
Rbl2 G A 8: 91,101,378 G574S probably damaging Het
Scamp1 T A 13: 94,208,174 T272S possibly damaging Het
Sun2 T A 15: 79,727,536 D562V probably damaging Het
Szt2 A G 4: 118,385,091 F1565S probably damaging Het
Tatdn2 C T 6: 113,710,164 R779C probably benign Het
Tbc1d30 T C 10: 121,275,734 I430V probably benign Het
Tmem86b T C 7: 4,629,726 D43G probably damaging Het
Tnrc18 T C 5: 142,787,733 N447S Het
Trmt2a T C 16: 18,251,169 S292P probably benign Het
Trpc2 T C 7: 102,088,285 V428A probably damaging Het
Tsc2 T C 17: 24,604,888 E981G probably damaging Het
Ucp1 G T 8: 83,290,643 G21* probably null Het
Utrn T C 10: 12,614,574 T21A probably benign Het
Vapa A T 17: 65,593,512 N88K probably damaging Het
Wasl T C 6: 24,664,616 R10G probably damaging Het
Zan C A 5: 137,393,548 V4662F unknown Het
Zap70 G A 1: 36,779,751 M382I possibly damaging Het
Zdhhc17 T C 10: 110,944,420 I624M probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9464:Mug2 UTSW 6 122051731 missense probably benign 0.01
R9622:Mug2 UTSW 6 122051792 missense probably benign 0.29
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGCCATTCTGATGTAATTCCTC -3'
(R):5'- ACCTGGAATAGAAGGCTTTGGG -3'

Sequencing Primer
(F):5'- CTCACTTCCAGGTGATATCTTGAG -3'
(R):5'- TGGCAGACTGTAAATCTGAAGGC -3'
Posted On 2022-02-07