Mutagenetix > Incidental Mutation

Incidental Mutation 'R9186:Ucp1'

697381

Institutional Source

Beutler Lab

Gene Symbol

Ucp1

Ensembl Gene

ENSMUSG00000031710

Gene Name

uncoupling protein 1 (mitochondrial, proton carrier)

Synonyms

Slc25a7

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9186 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84016981-84025081 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 84017272 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 21 (G21*)

Ref Sequence

ENSEMBL: ENSMUSP00000034146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034146]

AlphaFold

P12242

Predicted Effect

probably null
Transcript: ENSMUST00000034146
AA Change: G21*

SMART Domains

Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: G21*

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	5.7e-20	PFAM
Pfam:Mito_carr	109	206	3.3e-20	PFAM
Pfam:Mito_carr	209	300	1.6e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	C	A	9: 57,164,472 (GRCm39)	R634L	probably damaging	Het
Ankhd1	T	C	18: 36,767,383 (GRCm39)	I210T	possibly damaging	Het
Ankle2	G	A	5: 110,400,610 (GRCm39)	V649M	possibly damaging	Het
Arid3b	A	T	9: 57,702,217 (GRCm39)		probably null	Het
Arl10	A	G	13: 54,726,620 (GRCm39)	N133D	probably damaging	Het
Bag6	C	T	17: 35,363,667 (GRCm39)	R784W	probably damaging	Het
Ccnl1	T	C	3: 65,865,426 (GRCm39)	T42A	unknown	Het
Cd164	C	A	10: 41,404,695 (GRCm39)	P151Q	probably damaging	Het
Cdh23	G	A	10: 60,143,306 (GRCm39)	A3005V	possibly damaging	Het
Ceacam2	T	A	7: 25,227,213 (GRCm39)	N218I	probably damaging	Het
Cfap97	C	T	8: 46,644,665 (GRCm39)	R466C	possibly damaging	Het
Colgalt2	C	A	1: 152,384,403 (GRCm39)	T581K	probably damaging	Het
Dnah11	T	A	12: 118,154,632 (GRCm39)	D216V	probably benign	Het
Dusp13b	A	T	14: 21,798,563 (GRCm39)	S34T	probably damaging	Het
Esf1	T	A	2: 139,990,792 (GRCm39)	K564I	possibly damaging	Het
F5	A	G	1: 164,021,470 (GRCm39)	N1315S	probably benign	Het
Fubp1	A	T	3: 151,926,153 (GRCm39)	M292L	probably damaging	Het
Gabrb2	A	T	11: 42,378,200 (GRCm39)	M139L	possibly damaging	Het
Gk5	T	A	9: 96,015,469 (GRCm39)	V95D	probably benign	Het
Glcci1	C	A	6: 8,537,826 (GRCm39)	P148Q	possibly damaging	Het
Gm19410	A	T	8: 36,282,629 (GRCm39)	S1952C	possibly damaging	Het
Gstm4	T	C	3: 107,952,049 (GRCm39)		probably benign	Het
Heatr1	T	A	13: 12,436,227 (GRCm39)	L1211Q	probably damaging	Het
Helz2	A	G	2: 180,876,457 (GRCm39)	S1346P	possibly damaging	Het
Hexb	A	C	13: 97,325,836 (GRCm39)	V158G	probably damaging	Het
Hipk3	T	C	2: 104,301,439 (GRCm39)	E251G	probably damaging	Het
Hps5	T	C	7: 46,438,370 (GRCm39)	Y89C	probably damaging	Het
Iqub	A	T	6: 24,450,766 (GRCm39)	V611D	possibly damaging	Het
Itgbl1	G	A	14: 124,094,970 (GRCm39)	D332N	probably benign	Het
Krtap26-1	C	A	16: 88,444,609 (GRCm39)	R4L	unknown	Het
Lgi3	A	G	14: 70,772,193 (GRCm39)	Y246C	probably damaging	Het
Mug2	T	A	6: 122,052,248 (GRCm39)	I1002N	probably damaging	Het
Myo18a	C	T	11: 77,749,847 (GRCm39)	T66M		Het
Naip6	T	C	13: 100,436,390 (GRCm39)	D711G	possibly damaging	Het
Or4f59	C	A	2: 111,873,095 (GRCm39)	C94F	probably damaging	Het
Orc5	T	A	5: 22,752,944 (GRCm39)	Q48L	probably benign	Het
Oxct2a	C	A	4: 123,216,461 (GRCm39)	A307S	probably damaging	Het
Pgls	T	C	8: 72,048,833 (GRCm39)	*258Q	probably null	Het
Plekha6	C	T	1: 133,220,171 (GRCm39)	R955W	probably damaging	Het
Polr1c	G	T	17: 46,556,633 (GRCm39)	N97K	probably damaging	Het
Prr27	C	A	5: 87,990,994 (GRCm39)	P202Q	probably benign	Het
Prtg	T	C	9: 72,764,159 (GRCm39)	V544A	probably benign	Het
Rbl2	G	A	8: 91,828,006 (GRCm39)	G574S	probably damaging	Het
Scamp1	T	A	13: 94,344,682 (GRCm39)	T272S	possibly damaging	Het
Sun2	T	A	15: 79,611,737 (GRCm39)	D562V	probably damaging	Het
Szt2	A	G	4: 118,242,288 (GRCm39)	F1565S	probably damaging	Het
Tatdn2	C	T	6: 113,687,125 (GRCm39)	R779C	probably benign	Het
Tbc1d30	T	C	10: 121,111,639 (GRCm39)	I430V	probably benign	Het
Tmem86b	T	C	7: 4,632,725 (GRCm39)	D43G	probably damaging	Het
Tnrc18	T	C	5: 142,773,488 (GRCm39)	N447S		Het
Trmt2a	T	C	16: 18,069,033 (GRCm39)	S292P	probably benign	Het
Trpc2	T	C	7: 101,737,492 (GRCm39)	V428A	probably damaging	Het
Tsc2	T	C	17: 24,823,862 (GRCm39)	E981G	probably damaging	Het
Utrn	T	C	10: 12,490,318 (GRCm39)	T21A	probably benign	Het
Vapa	A	T	17: 65,900,507 (GRCm39)	N88K	probably damaging	Het
Wasl	T	C	6: 24,664,615 (GRCm39)	R10G	probably damaging	Het
Zan	C	A	5: 137,391,810 (GRCm39)	V4662F	unknown	Het
Zap70	G	A	1: 36,818,832 (GRCm39)	M382I	possibly damaging	Het
Zdhhc17	T	C	10: 110,780,281 (GRCm39)	I624M	probably benign	Het

Other mutations in Ucp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4585001:Ucp1	UTSW	8	84,020,577 (GRCm39)	missense	probably damaging	1.00
R0050:Ucp1	UTSW	8	84,020,857 (GRCm39)	missense	probably damaging	1.00
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0055:Ucp1	UTSW	8	84,017,233 (GRCm39)	nonsense	probably null
R0505:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0590:Ucp1	UTSW	8	84,018,232 (GRCm39)	splice site	probably benign
R0681:Ucp1	UTSW	8	84,021,936 (GRCm39)	missense	possibly damaging	0.78
R0731:Ucp1	UTSW	8	84,024,476 (GRCm39)	splice site	probably benign
R1606:Ucp1	UTSW	8	84,021,933 (GRCm39)	missense	probably damaging	1.00
R1722:Ucp1	UTSW	8	84,017,317 (GRCm39)	missense	probably benign	0.25
R1809:Ucp1	UTSW	8	84,024,496 (GRCm39)	missense	probably damaging	0.99
R1823:Ucp1	UTSW	8	84,020,661 (GRCm39)	missense	probably damaging	1.00
R3809:Ucp1	UTSW	8	84,017,270 (GRCm39)	missense	probably damaging	0.99
R4085:Ucp1	UTSW	8	84,020,580 (GRCm39)	missense	probably benign	0.43
R4673:Ucp1	UTSW	8	84,021,876 (GRCm39)	missense	probably damaging	1.00
R4998:Ucp1	UTSW	8	84,024,484 (GRCm39)	critical splice acceptor site	probably null
R5163:Ucp1	UTSW	8	84,020,832 (GRCm39)	missense	possibly damaging	0.95
R5421:Ucp1	UTSW	8	84,017,320 (GRCm39)	missense	probably benign	0.12
R5790:Ucp1	UTSW	8	84,024,520 (GRCm39)	missense	possibly damaging	0.54
R5994:Ucp1	UTSW	8	84,020,567 (GRCm39)	missense	possibly damaging	0.92
R6574:Ucp1	UTSW	8	84,020,718 (GRCm39)	critical splice donor site	probably null
R6732:Ucp1	UTSW	8	84,018,106 (GRCm39)	missense	probably benign	0.08
R7282:Ucp1	UTSW	8	84,020,531 (GRCm39)	missense	probably benign	0.03
R7343:Ucp1	UTSW	8	84,021,881 (GRCm39)	missense	probably damaging	0.99
R7878:Ucp1	UTSW	8	84,024,521 (GRCm39)	missense	probably benign	0.19
R8008:Ucp1	UTSW	8	84,020,640 (GRCm39)	missense	probably benign	0.32
R8365:Ucp1	UTSW	8	84,020,628 (GRCm39)	missense	probably damaging	0.97
R8899:Ucp1	UTSW	8	84,017,216 (GRCm39)	missense	probably benign	0.35
R9499:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9551:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00
R9552:Ucp1	UTSW	8	84,024,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATCTGGGCTTAACGGGTC -3'
(R):5'- AATCCAAGGGCCCCATTTC -3'

Sequencing Primer
(F):5'- AAGGGACGCTCACCTTTG -3'
(R):5'- AAGGGCCCCATTTCCTTCCTAATAG -3'

Posted On

2022-02-07