Incidental Mutation 'R9186:Krtap26-1'
ID 697405
Institutional Source Beutler Lab
Gene Symbol Krtap26-1
Ensembl Gene ENSMUSG00000071471
Gene Name keratin associated protein 26-1
Synonyms 2310002B14Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9186 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 88443712-88444684 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 88444609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 4 (R4L)
Ref Sequence ENSEMBL: ENSMUSP00000093626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095934]
AlphaFold Q9D7N2
Predicted Effect unknown
Transcript: ENSMUST00000095934
AA Change: R4L
SMART Domains Protein: ENSMUSP00000093626
Gene: ENSMUSG00000071471
AA Change: R4L

DomainStartEndE-ValueType
Pfam:PMG 4 213 2.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,164,472 (GRCm39) R634L probably damaging Het
Ankhd1 T C 18: 36,767,383 (GRCm39) I210T possibly damaging Het
Ankle2 G A 5: 110,400,610 (GRCm39) V649M possibly damaging Het
Arid3b A T 9: 57,702,217 (GRCm39) probably null Het
Arl10 A G 13: 54,726,620 (GRCm39) N133D probably damaging Het
Bag6 C T 17: 35,363,667 (GRCm39) R784W probably damaging Het
Ccnl1 T C 3: 65,865,426 (GRCm39) T42A unknown Het
Cd164 C A 10: 41,404,695 (GRCm39) P151Q probably damaging Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Ceacam2 T A 7: 25,227,213 (GRCm39) N218I probably damaging Het
Cfap97 C T 8: 46,644,665 (GRCm39) R466C possibly damaging Het
Colgalt2 C A 1: 152,384,403 (GRCm39) T581K probably damaging Het
Dnah11 T A 12: 118,154,632 (GRCm39) D216V probably benign Het
Dusp13b A T 14: 21,798,563 (GRCm39) S34T probably damaging Het
Esf1 T A 2: 139,990,792 (GRCm39) K564I possibly damaging Het
F5 A G 1: 164,021,470 (GRCm39) N1315S probably benign Het
Fubp1 A T 3: 151,926,153 (GRCm39) M292L probably damaging Het
Gabrb2 A T 11: 42,378,200 (GRCm39) M139L possibly damaging Het
Gk5 T A 9: 96,015,469 (GRCm39) V95D probably benign Het
Glcci1 C A 6: 8,537,826 (GRCm39) P148Q possibly damaging Het
Gm19410 A T 8: 36,282,629 (GRCm39) S1952C possibly damaging Het
Gstm4 T C 3: 107,952,049 (GRCm39) probably benign Het
Heatr1 T A 13: 12,436,227 (GRCm39) L1211Q probably damaging Het
Helz2 A G 2: 180,876,457 (GRCm39) S1346P possibly damaging Het
Hexb A C 13: 97,325,836 (GRCm39) V158G probably damaging Het
Hipk3 T C 2: 104,301,439 (GRCm39) E251G probably damaging Het
Hps5 T C 7: 46,438,370 (GRCm39) Y89C probably damaging Het
Iqub A T 6: 24,450,766 (GRCm39) V611D possibly damaging Het
Itgbl1 G A 14: 124,094,970 (GRCm39) D332N probably benign Het
Lgi3 A G 14: 70,772,193 (GRCm39) Y246C probably damaging Het
Mug2 T A 6: 122,052,248 (GRCm39) I1002N probably damaging Het
Myo18a C T 11: 77,749,847 (GRCm39) T66M Het
Naip6 T C 13: 100,436,390 (GRCm39) D711G possibly damaging Het
Or4f59 C A 2: 111,873,095 (GRCm39) C94F probably damaging Het
Orc5 T A 5: 22,752,944 (GRCm39) Q48L probably benign Het
Oxct2a C A 4: 123,216,461 (GRCm39) A307S probably damaging Het
Pgls T C 8: 72,048,833 (GRCm39) *258Q probably null Het
Plekha6 C T 1: 133,220,171 (GRCm39) R955W probably damaging Het
Polr1c G T 17: 46,556,633 (GRCm39) N97K probably damaging Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prtg T C 9: 72,764,159 (GRCm39) V544A probably benign Het
Rbl2 G A 8: 91,828,006 (GRCm39) G574S probably damaging Het
Scamp1 T A 13: 94,344,682 (GRCm39) T272S possibly damaging Het
Sun2 T A 15: 79,611,737 (GRCm39) D562V probably damaging Het
Szt2 A G 4: 118,242,288 (GRCm39) F1565S probably damaging Het
Tatdn2 C T 6: 113,687,125 (GRCm39) R779C probably benign Het
Tbc1d30 T C 10: 121,111,639 (GRCm39) I430V probably benign Het
Tmem86b T C 7: 4,632,725 (GRCm39) D43G probably damaging Het
Tnrc18 T C 5: 142,773,488 (GRCm39) N447S Het
Trmt2a T C 16: 18,069,033 (GRCm39) S292P probably benign Het
Trpc2 T C 7: 101,737,492 (GRCm39) V428A probably damaging Het
Tsc2 T C 17: 24,823,862 (GRCm39) E981G probably damaging Het
Ucp1 G T 8: 84,017,272 (GRCm39) G21* probably null Het
Utrn T C 10: 12,490,318 (GRCm39) T21A probably benign Het
Vapa A T 17: 65,900,507 (GRCm39) N88K probably damaging Het
Wasl T C 6: 24,664,615 (GRCm39) R10G probably damaging Het
Zan C A 5: 137,391,810 (GRCm39) V4662F unknown Het
Zap70 G A 1: 36,818,832 (GRCm39) M382I possibly damaging Het
Zdhhc17 T C 10: 110,780,281 (GRCm39) I624M probably benign Het
Other mutations in Krtap26-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Krtap26-1 APN 16 88,444,267 (GRCm39) missense possibly damaging 0.62
IGL01721:Krtap26-1 APN 16 88,444,060 (GRCm39) missense probably damaging 1.00
IGL01963:Krtap26-1 APN 16 88,444,556 (GRCm39) missense probably damaging 1.00
IGL02524:Krtap26-1 APN 16 88,444,367 (GRCm39) missense possibly damaging 0.70
R0383:Krtap26-1 UTSW 16 88,444,131 (GRCm39) nonsense probably null
R2367:Krtap26-1 UTSW 16 88,444,213 (GRCm39) missense probably benign 0.28
R4694:Krtap26-1 UTSW 16 88,444,108 (GRCm39) missense possibly damaging 0.70
R6699:Krtap26-1 UTSW 16 88,444,603 (GRCm39) missense unknown
R6884:Krtap26-1 UTSW 16 88,444,467 (GRCm39) missense probably damaging 1.00
R7299:Krtap26-1 UTSW 16 88,444,132 (GRCm39) missense possibly damaging 0.49
R7808:Krtap26-1 UTSW 16 88,444,198 (GRCm39) missense not run
R8824:Krtap26-1 UTSW 16 88,444,324 (GRCm39) missense probably damaging 0.99
R8824:Krtap26-1 UTSW 16 88,444,303 (GRCm39) missense probably damaging 1.00
R9034:Krtap26-1 UTSW 16 88,444,161 (GRCm39) missense probably benign 0.14
R9279:Krtap26-1 UTSW 16 88,444,342 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTTGTCCATGAACCAGG -3'
(R):5'- AAGGTATTTCAGGGATCATCCGG -3'

Sequencing Primer
(F):5'- TCCATGAACCAGGTGTGATC -3'
(R):5'- CGCTACTTCCTGGGTATGAGAGAG -3'
Posted On 2022-02-07