Incidental Mutation 'R9187:Hipk3'
ID 697420
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9187 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104276936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 381 (D381V)
Ref Sequence ENSEMBL: ENSMUSP00000028600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably damaging
Transcript: ENSMUST00000028600
AA Change: D381V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: D381V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111124
AA Change: D381V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: D381V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111125
AA Change: D381V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: D381V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,200,961 (GRCm39) probably null Het
Abcb1a T A 5: 8,765,016 (GRCm39) C669S probably benign Het
Abcc3 A G 11: 94,255,913 (GRCm39) L524P probably damaging Het
Akap5 A T 12: 76,376,745 (GRCm39) K726* probably null Het
Aldh16a1 T C 7: 44,791,441 (GRCm39) E778G probably damaging Het
Ankle2 G A 5: 110,400,610 (GRCm39) V649M possibly damaging Het
Apon A G 10: 128,090,832 (GRCm39) N170S probably benign Het
Baiap2l1 T C 5: 144,217,764 (GRCm39) Y274C probably benign Het
Bub1 A T 2: 127,656,856 (GRCm39) N425K possibly damaging Het
Camsap1 A G 2: 25,820,028 (GRCm39) C1487R probably damaging Het
Cd4 A C 6: 124,844,651 (GRCm39) V378G probably damaging Het
Cenpa C A 5: 30,824,380 (GRCm39) P3Q unknown Het
Cfap44 T C 16: 44,225,144 (GRCm39) probably benign Het
Cfap65 T A 1: 74,956,517 (GRCm39) M1021L probably benign Het
Ddx39a G T 8: 84,449,113 (GRCm39) M300I probably benign Het
Dgkh T C 14: 78,832,601 (GRCm39) R819G probably damaging Het
Dlc1 A T 8: 37,405,786 (GRCm39) M1K probably null Het
Dnah9 A G 11: 65,895,972 (GRCm39) W2468R probably benign Het
Ebag9 A T 15: 44,503,706 (GRCm39) K177I probably damaging Het
Ehbp1 T C 11: 22,101,184 (GRCm39) I249V probably damaging Het
Fam171b T C 2: 83,710,365 (GRCm39) V679A probably damaging Het
Gabbr2 G A 4: 46,674,533 (GRCm39) T818I probably damaging Het
Gcn1 T C 5: 115,752,177 (GRCm39) S2098P probably damaging Het
Glb1 T C 9: 114,302,991 (GRCm39) I609T probably damaging Het
Gm5916 T G 9: 36,032,020 (GRCm39) H88P probably benign Het
Gon4l T C 3: 88,786,618 (GRCm39) S586P probably benign Het
Gzmg T A 14: 56,394,714 (GRCm39) T185S probably benign Het
Hnrnpul2 C A 19: 8,808,319 (GRCm39) N681K probably benign Het
Hpdl C A 4: 116,678,372 (GRCm39) G30C probably damaging Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Krt82 C A 15: 101,450,260 (GRCm39) V479L probably benign Het
Lama4 G A 10: 38,924,124 (GRCm39) probably null Het
Lamc1 C A 1: 153,097,434 (GRCm39) E1537* probably null Het
Mab21l3 G A 3: 101,730,594 (GRCm39) T215M probably benign Het
Magi3 C A 3: 103,923,073 (GRCm39) V1215F possibly damaging Het
Mical2 T A 7: 111,902,797 (GRCm39) C89* probably null Het
Mitf T A 6: 97,994,835 (GRCm39) V427D probably benign Het
Muc4 T C 16: 32,589,102 (GRCm39) V753A Het
Myo16 G A 8: 10,492,233 (GRCm39) R725H unknown Het
Ncapg2 T A 12: 116,402,287 (GRCm39) D706E probably damaging Het
Ndst1 T C 18: 60,824,268 (GRCm39) D803G probably benign Het
Neb A T 2: 52,096,115 (GRCm39) V5065D probably damaging Het
Npm3 G A 19: 45,737,941 (GRCm39) R19* probably null Het
Ntrk3 A C 7: 77,896,966 (GRCm39) N690K possibly damaging Het
Or7g32 T C 9: 19,389,166 (GRCm39) I127V probably benign Het
Or7g35 T C 9: 19,495,950 (GRCm39) I39T probably benign Het
Or8d4 C A 9: 40,038,886 (GRCm39) V124L possibly damaging Het
P3h2 G A 16: 25,924,186 (GRCm39) A83V probably benign Het
Pdia2 A G 17: 26,415,910 (GRCm39) S362P probably damaging Het
Pmp22 C T 11: 63,025,268 (GRCm39) H34Y probably benign Het
Pmp22 T C 11: 63,025,317 (GRCm39) V50A probably benign Het
Ppfia4 T C 1: 134,255,006 (GRCm39) D283G probably damaging Het
Pramel58 T C 5: 94,831,755 (GRCm39) V254A probably benign Het
Prss55 T A 14: 64,314,531 (GRCm39) Q213L probably null Het
Rgsl1 C T 1: 153,669,613 (GRCm39) E258K possibly damaging Het
Ripor2 T C 13: 24,897,632 (GRCm39) F777L probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,229,140 (GRCm39) probably benign Het
Sgce G A 6: 4,711,362 (GRCm39) R173C probably benign Het
Sncaip T G 18: 53,040,011 (GRCm39) M735R probably benign Het
Snrpd2 T A 7: 18,886,505 (GRCm39) I96N probably damaging Het
Spryd3 T G 15: 102,039,110 (GRCm39) D121A probably damaging Het
Srsf3-ps A G 11: 98,516,187 (GRCm39) V62A possibly damaging Het
Sspo T C 6: 48,472,223 (GRCm39) C149R probably damaging Het
Tbc1d10b A T 7: 126,807,105 (GRCm39) M144K probably benign Het
Tbc1d31 T A 15: 57,779,485 (GRCm39) I66N probably damaging Het
Tssk1 A G 16: 17,712,457 (GRCm39) T81A possibly damaging Het
Ttc28 A G 5: 111,249,902 (GRCm39) Y284C probably damaging Het
Ttn T C 2: 76,573,755 (GRCm39) T25713A probably benign Het
Vmn2r125 T C 4: 156,703,554 (GRCm39) W311R probably damaging Het
Vmn2r80 A T 10: 79,030,438 (GRCm39) T755S probably benign Het
Vmn2r98 T C 17: 19,301,481 (GRCm39) C828R probably damaging Het
Wwox T C 8: 115,438,978 (GRCm39) F348S probably damaging Het
Zeb2 T A 2: 45,000,040 (GRCm39) R65W possibly damaging Het
Zfp712 T A 13: 67,188,637 (GRCm39) H630L probably damaging Het
Zfp764 G T 7: 127,004,608 (GRCm39) H174Q probably damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0277:Hipk3 UTSW 2 104,271,593 (GRCm39) missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4604:Hipk3 UTSW 2 104,269,674 (GRCm39) missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104,268,242 (GRCm39) missense probably benign 0.21
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9374:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9584:Hipk3 UTSW 2 104,301,910 (GRCm39) missense probably benign 0.01
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGACATTCATGGAGATTTTC -3'
(R):5'- TGACCGAGGGTTAGGATCG -3'

Sequencing Primer
(F):5'- CACATTTTGTGTATGGAGAATCATGC -3'
(R):5'- GTTTGACAAGTTCTCAGCGAC -3'
Posted On 2022-02-07