Incidental Mutation 'R9187:Olfr850'
ID 697450
Institutional Source Beutler Lab
Gene Symbol Olfr850
Ensembl Gene ENSMUSG00000094535
Gene Name olfactory receptor 850
Synonyms GA_x6K02T2PVTD-13214162-13213224, MOR147-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock # R9187 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19477301-19478248 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19477870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 127 (I127V)
Ref Sequence ENSEMBL: ENSMUSP00000076569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077347] [ENSMUST00000211832]
AlphaFold Q8VFF2
Predicted Effect probably benign
Transcript: ENSMUST00000077347
AA Change: I127V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076569
Gene: ENSMUSG00000094535
AA Change: I127V

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 38 304 1e-6 PFAM
Pfam:7tm_1 44 293 5.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211832
AA Change: I124V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,310,135 probably null Het
Abcb1a T A 5: 8,715,016 C669S probably benign Het
Abcc3 A G 11: 94,365,087 L524P probably damaging Het
Akap5 A T 12: 76,329,971 K726* probably null Het
Aldh16a1 T C 7: 45,142,017 E778G probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Apon A G 10: 128,254,963 N170S probably benign Het
Baiap2l1 T C 5: 144,280,954 Y274C probably benign Het
Bub1 A T 2: 127,814,936 N425K possibly damaging Het
Camsap1 A G 2: 25,930,016 C1487R probably damaging Het
Cd4 A C 6: 124,867,688 V378G probably damaging Het
Cenpa C A 5: 30,667,036 P3Q unknown Het
Cfap65 T A 1: 74,917,358 M1021L probably benign Het
Ddx39 G T 8: 83,722,484 M300I probably benign Het
Dgkh T C 14: 78,595,161 R819G probably damaging Het
Dlc1 A T 8: 36,938,632 M1K probably null Het
Dnah9 A G 11: 66,005,146 W2468R probably benign Het
Ebag9 A T 15: 44,640,310 K177I probably damaging Het
Ehbp1 T C 11: 22,151,184 I249V probably damaging Het
Fam171b T C 2: 83,880,021 V679A probably damaging Het
Gabbr2 G A 4: 46,674,533 T818I probably damaging Het
Gcn1l1 T C 5: 115,614,118 S2098P probably damaging Het
Glb1 T C 9: 114,473,923 I609T probably damaging Het
Gm12355 A G 11: 98,625,361 V62A possibly damaging Het
Gm5916 T G 9: 36,120,724 H88P probably benign Het
Gm6205 T C 5: 94,683,896 V254A probably benign Het
Gon4l T C 3: 88,879,311 S586P probably benign Het
Gzmg T A 14: 56,157,257 T185S probably benign Het
Hipk3 T A 2: 104,446,591 D381V probably damaging Het
Hnrnpul2 C A 19: 8,830,955 N681K probably benign Het
Hpdl C A 4: 116,821,175 G30C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Krt82 C A 15: 101,541,825 V479L probably benign Het
Lama4 G A 10: 39,048,128 probably null Het
Lamc1 C A 1: 153,221,688 E1537* probably null Het
Mab21l3 G A 3: 101,823,278 T215M probably benign Het
Magi3 C A 3: 104,015,757 V1215F possibly damaging Het
Mical2 T A 7: 112,303,590 C89* probably null Het
Mitf T A 6: 98,017,874 V427D probably benign Het
Muc4 T C 16: 32,768,728 V753A Het
Myo16 G A 8: 10,442,233 R725H unknown Het
Ncapg2 T A 12: 116,438,667 D706E probably damaging Het
Ndst1 T C 18: 60,691,196 D803G probably benign Het
Neb A T 2: 52,206,103 V5065D probably damaging Het
Npm3 G A 19: 45,749,502 R19* probably null Het
Ntrk3 A C 7: 78,247,218 N690K possibly damaging Het
Olfr855 T C 9: 19,584,654 I39T probably benign Het
Olfr985 C A 9: 40,127,590 V124L possibly damaging Het
P3h2 G A 16: 26,105,436 A83V probably benign Het
Pdia2 A G 17: 26,196,936 S362P probably damaging Het
Pmp22 C T 11: 63,134,442 H34Y probably benign Het
Pmp22 T C 11: 63,134,491 V50A probably benign Het
Ppfia4 T C 1: 134,327,268 D283G probably damaging Het
Prss55 T A 14: 64,077,082 Q213L probably null Het
Rgsl1 C T 1: 153,793,867 E258K possibly damaging Het
Ripor2 T C 13: 24,713,649 F777L probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Sgce G A 6: 4,711,362 R173C probably benign Het
Sncaip T G 18: 52,906,939 M735R probably benign Het
Snrpd2 T A 7: 19,152,580 I96N probably damaging Het
Spryd3 T G 15: 102,130,675 D121A probably damaging Het
Sspo T C 6: 48,495,289 C149R probably damaging Het
Tbc1d10b A T 7: 127,207,933 M144K probably benign Het
Tbc1d31 T A 15: 57,916,089 I66N probably damaging Het
Tssk1 A G 16: 17,894,593 T81A possibly damaging Het
Ttc28 A G 5: 111,102,036 Y284C probably damaging Het
Ttn T C 2: 76,743,411 T25713A probably benign Het
Vmn2r125 T C 4: 156,351,259 W311R probably damaging Het
Vmn2r80 A T 10: 79,194,604 T755S probably benign Het
Vmn2r98 T C 17: 19,081,219 C828R probably damaging Het
Wwox T C 8: 114,712,238 F348S probably damaging Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp712 T A 13: 67,040,573 H630L probably damaging Het
Zfp764 G T 7: 127,405,436 H174Q probably damaging Het
Other mutations in Olfr850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02723:Olfr850 APN 9 19477509 missense probably damaging 1.00
IGL03294:Olfr850 APN 9 19477989 missense possibly damaging 0.95
PIT4305001:Olfr850 UTSW 9 19478061 missense probably damaging 1.00
R0364:Olfr850 UTSW 9 19477972 nonsense probably null
R0379:Olfr850 UTSW 9 19477480 missense possibly damaging 0.75
R0449:Olfr850 UTSW 9 19478092 missense possibly damaging 0.89
R0682:Olfr850 UTSW 9 19477349 missense probably benign 0.03
R0693:Olfr850 UTSW 9 19477972 nonsense probably null
R1484:Olfr850 UTSW 9 19478127 missense probably damaging 1.00
R1599:Olfr850 UTSW 9 19478221 missense probably damaging 0.97
R1626:Olfr850 UTSW 9 19478199 missense probably damaging 1.00
R1742:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R4232:Olfr850 UTSW 9 19477726 missense probably damaging 0.98
R4237:Olfr850 UTSW 9 19477597 missense probably benign 0.00
R5116:Olfr850 UTSW 9 19477798 missense possibly damaging 0.67
R5643:Olfr850 UTSW 9 19477557 missense probably benign 0.22
R6271:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R6815:Olfr850 UTSW 9 19477765 missense probably benign 0.20
R7222:Olfr850 UTSW 9 19477467 missense probably damaging 1.00
R7592:Olfr850 UTSW 9 19477832 missense possibly damaging 0.52
R8155:Olfr850 UTSW 9 19478157 missense probably benign 0.17
R8813:Olfr850 UTSW 9 19478181 missense possibly damaging 0.75
R9528:Olfr850 UTSW 9 19478148 missense probably damaging 1.00
RF034:Olfr850 UTSW 9 19477632 missense possibly damaging 0.46
X0058:Olfr850 UTSW 9 19478223 missense probably benign 0.10
Z1177:Olfr850 UTSW 9 19477337 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCCAACTTGAGGATCTGG -3'
(R):5'- TGATCACCATCCTGGGAAAC -3'

Sequencing Primer
(F):5'- CAACTTGAGGATCTGGGGAAGTTC -3'
(R):5'- TCTCCAATTTGTCCTTAAATGACATC -3'
Posted On 2022-02-07