Incidental Mutation 'R9187:Olfr855'
ID 697451
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Name olfactory receptor 855
Synonyms MOR148-1, GA_x6K02T2PVTD-13330461-13331399
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9187 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19582617-19586030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19584654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 39 (I39T)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably benign
Transcript: ENSMUST00000061693
AA Change: I39T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: I39T

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215587
AA Change: I39T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,310,135 probably null Het
Abcb1a T A 5: 8,715,016 C669S probably benign Het
Abcc3 A G 11: 94,365,087 L524P probably damaging Het
Akap5 A T 12: 76,329,971 K726* probably null Het
Aldh16a1 T C 7: 45,142,017 E778G probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Apon A G 10: 128,254,963 N170S probably benign Het
Baiap2l1 T C 5: 144,280,954 Y274C probably benign Het
Bub1 A T 2: 127,814,936 N425K possibly damaging Het
Camsap1 A G 2: 25,930,016 C1487R probably damaging Het
Cd4 A C 6: 124,867,688 V378G probably damaging Het
Cenpa C A 5: 30,667,036 P3Q unknown Het
Cfap65 T A 1: 74,917,358 M1021L probably benign Het
Ddx39 G T 8: 83,722,484 M300I probably benign Het
Dgkh T C 14: 78,595,161 R819G probably damaging Het
Dlc1 A T 8: 36,938,632 M1K probably null Het
Dnah9 A G 11: 66,005,146 W2468R probably benign Het
Ebag9 A T 15: 44,640,310 K177I probably damaging Het
Ehbp1 T C 11: 22,151,184 I249V probably damaging Het
Fam171b T C 2: 83,880,021 V679A probably damaging Het
Gabbr2 G A 4: 46,674,533 T818I probably damaging Het
Gcn1l1 T C 5: 115,614,118 S2098P probably damaging Het
Glb1 T C 9: 114,473,923 I609T probably damaging Het
Gm12355 A G 11: 98,625,361 V62A possibly damaging Het
Gm5916 T G 9: 36,120,724 H88P probably benign Het
Gm6205 T C 5: 94,683,896 V254A probably benign Het
Gon4l T C 3: 88,879,311 S586P probably benign Het
Gzmg T A 14: 56,157,257 T185S probably benign Het
Hipk3 T A 2: 104,446,591 D381V probably damaging Het
Hnrnpul2 C A 19: 8,830,955 N681K probably benign Het
Hpdl C A 4: 116,821,175 G30C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Krt82 C A 15: 101,541,825 V479L probably benign Het
Lama4 G A 10: 39,048,128 probably null Het
Lamc1 C A 1: 153,221,688 E1537* probably null Het
Mab21l3 G A 3: 101,823,278 T215M probably benign Het
Magi3 C A 3: 104,015,757 V1215F possibly damaging Het
Mical2 T A 7: 112,303,590 C89* probably null Het
Mitf T A 6: 98,017,874 V427D probably benign Het
Muc4 T C 16: 32,768,728 V753A Het
Myo16 G A 8: 10,442,233 R725H unknown Het
Ncapg2 T A 12: 116,438,667 D706E probably damaging Het
Ndst1 T C 18: 60,691,196 D803G probably benign Het
Neb A T 2: 52,206,103 V5065D probably damaging Het
Npm3 G A 19: 45,749,502 R19* probably null Het
Ntrk3 A C 7: 78,247,218 N690K possibly damaging Het
Olfr850 T C 9: 19,477,870 I127V probably benign Het
Olfr985 C A 9: 40,127,590 V124L possibly damaging Het
P3h2 G A 16: 26,105,436 A83V probably benign Het
Pdia2 A G 17: 26,196,936 S362P probably damaging Het
Pmp22 C T 11: 63,134,442 H34Y probably benign Het
Pmp22 T C 11: 63,134,491 V50A probably benign Het
Ppfia4 T C 1: 134,327,268 D283G probably damaging Het
Prss55 T A 14: 64,077,082 Q213L probably null Het
Rgsl1 C T 1: 153,793,867 E258K possibly damaging Het
Ripor2 T C 13: 24,713,649 F777L probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Sgce G A 6: 4,711,362 R173C probably benign Het
Sncaip T G 18: 52,906,939 M735R probably benign Het
Snrpd2 T A 7: 19,152,580 I96N probably damaging Het
Spryd3 T G 15: 102,130,675 D121A probably damaging Het
Sspo T C 6: 48,495,289 C149R probably damaging Het
Tbc1d10b A T 7: 127,207,933 M144K probably benign Het
Tbc1d31 T A 15: 57,916,089 I66N probably damaging Het
Tssk1 A G 16: 17,894,593 T81A possibly damaging Het
Ttc28 A G 5: 111,102,036 Y284C probably damaging Het
Ttn T C 2: 76,743,411 T25713A probably benign Het
Vmn2r125 T C 4: 156,351,259 W311R probably damaging Het
Vmn2r80 A T 10: 79,194,604 T755S probably benign Het
Vmn2r98 T C 17: 19,081,219 C828R probably damaging Het
Wwox T C 8: 114,712,238 F348S probably damaging Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp712 T A 13: 67,040,573 H630L probably damaging Het
Zfp764 G T 7: 127,405,436 H174Q probably damaging Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
R8470:Olfr855 UTSW 9 19584969 missense probably damaging 0.99
R9155:Olfr855 UTSW 9 19585083 missense probably benign 0.00
R9422:Olfr855 UTSW 9 19584672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAGCATGGCATGGAAG -3'
(R):5'- GCAGTCTGTGTAAGTGATGCTC -3'

Sequencing Primer
(F):5'- CTTGAGCATGGCATGGAAGTAGTTAG -3'
(R):5'- AAGTGATGCTCTGGTCATTTGC -3'
Posted On 2022-02-07