Mutagenetix > Incidental Mutation

Incidental Mutation 'R9187:Ncapg2'

697466

Institutional Source

Beutler Lab

Gene Symbol

Ncapg2

Ensembl Gene

ENSMUSG00000042029

Gene Name

non-SMC condensin II complex, subunit G2

Synonyms

Luzp5, 5830426I05Rik, mCAP-G2, Mtb

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9187 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116405402-116463731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116438667 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 706 (D706E)

Ref Sequence

ENSEMBL: ENSMUSP00000081889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084828]

AlphaFold

Q6DFV1

Predicted Effect

probably damaging
Transcript: ENSMUST00000084828
AA Change: D706E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: D706E

Domain	Start	End	E-Value	Type
low complexity region	14	25	N/A	INTRINSIC
Pfam:Condensin2nSMC	212	361	7.2e-62	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,310,135		probably null	Het
Abcb1a	T	A	5: 8,715,016	C669S	probably benign	Het
Abcc3	A	G	11: 94,365,087	L524P	probably damaging	Het
Akap5	A	T	12: 76,329,971	K726*	probably null	Het
Aldh16a1	T	C	7: 45,142,017	E778G	probably damaging	Het
Ankle2	G	A	5: 110,252,744	V649M	possibly damaging	Het
Apon	A	G	10: 128,254,963	N170S	probably benign	Het
Baiap2l1	T	C	5: 144,280,954	Y274C	probably benign	Het
Bub1	A	T	2: 127,814,936	N425K	possibly damaging	Het
Camsap1	A	G	2: 25,930,016	C1487R	probably damaging	Het
Cd4	A	C	6: 124,867,688	V378G	probably damaging	Het
Cenpa	C	A	5: 30,667,036	P3Q	unknown	Het
Cfap65	T	A	1: 74,917,358	M1021L	probably benign	Het
Ddx39	G	T	8: 83,722,484	M300I	probably benign	Het
Dgkh	T	C	14: 78,595,161	R819G	probably damaging	Het
Dlc1	A	T	8: 36,938,632	M1K	probably null	Het
Dnah9	A	G	11: 66,005,146	W2468R	probably benign	Het
Ebag9	A	T	15: 44,640,310	K177I	probably damaging	Het
Ehbp1	T	C	11: 22,151,184	I249V	probably damaging	Het
Fam171b	T	C	2: 83,880,021	V679A	probably damaging	Het
Gabbr2	G	A	4: 46,674,533	T818I	probably damaging	Het
Gcn1l1	T	C	5: 115,614,118	S2098P	probably damaging	Het
Glb1	T	C	9: 114,473,923	I609T	probably damaging	Het
Gm12355	A	G	11: 98,625,361	V62A	possibly damaging	Het
Gm5916	T	G	9: 36,120,724	H88P	probably benign	Het
Gm6205	T	C	5: 94,683,896	V254A	probably benign	Het
Gon4l	T	C	3: 88,879,311	S586P	probably benign	Het
Gzmg	T	A	14: 56,157,257	T185S	probably benign	Het
Hipk3	T	A	2: 104,446,591	D381V	probably damaging	Het
Hnrnpul2	C	A	19: 8,830,955	N681K	probably benign	Het
Hpdl	C	A	4: 116,821,175	G30C	probably damaging	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Krt82	C	A	15: 101,541,825	V479L	probably benign	Het
Lama4	G	A	10: 39,048,128		probably null	Het
Lamc1	C	A	1: 153,221,688	E1537*	probably null	Het
Mab21l3	G	A	3: 101,823,278	T215M	probably benign	Het
Magi3	C	A	3: 104,015,757	V1215F	possibly damaging	Het
Mical2	T	A	7: 112,303,590	C89*	probably null	Het
Mitf	T	A	6: 98,017,874	V427D	probably benign	Het
Muc4	T	C	16: 32,768,728	V753A		Het
Myo16	G	A	8: 10,442,233	R725H	unknown	Het
Ndst1	T	C	18: 60,691,196	D803G	probably benign	Het
Neb	A	T	2: 52,206,103	V5065D	probably damaging	Het
Npm3	G	A	19: 45,749,502	R19*	probably null	Het
Ntrk3	A	C	7: 78,247,218	N690K	possibly damaging	Het
Olfr850	T	C	9: 19,477,870	I127V	probably benign	Het
Olfr855	T	C	9: 19,584,654	I39T	probably benign	Het
Olfr985	C	A	9: 40,127,590	V124L	possibly damaging	Het
P3h2	G	A	16: 26,105,436	A83V	probably benign	Het
Pdia2	A	G	17: 26,196,936	S362P	probably damaging	Het
Pmp22	C	T	11: 63,134,442	H34Y	probably benign	Het
Pmp22	T	C	11: 63,134,491	V50A	probably benign	Het
Ppfia4	T	C	1: 134,327,268	D283G	probably damaging	Het
Prss55	T	A	14: 64,077,082	Q213L	probably null	Het
Rgsl1	C	T	1: 153,793,867	E258K	possibly damaging	Het
Ripor2	T	C	13: 24,713,649	F777L	probably benign	Het
Rsf1	GGC	GGCGGCGGCCGC	7: 97,579,933		probably benign	Het
Sgce	G	A	6: 4,711,362	R173C	probably benign	Het
Sncaip	T	G	18: 52,906,939	M735R	probably benign	Het
Snrpd2	T	A	7: 19,152,580	I96N	probably damaging	Het
Spryd3	T	G	15: 102,130,675	D121A	probably damaging	Het
Sspo	T	C	6: 48,495,289	C149R	probably damaging	Het
Tbc1d10b	A	T	7: 127,207,933	M144K	probably benign	Het
Tbc1d31	T	A	15: 57,916,089	I66N	probably damaging	Het
Tssk1	A	G	16: 17,894,593	T81A	possibly damaging	Het
Ttc28	A	G	5: 111,102,036	Y284C	probably damaging	Het
Ttn	T	C	2: 76,743,411	T25713A	probably benign	Het
Vmn2r125	T	C	4: 156,351,259	W311R	probably damaging	Het
Vmn2r80	A	T	10: 79,194,604	T755S	probably benign	Het
Vmn2r98	T	C	17: 19,081,219	C828R	probably damaging	Het
Wwox	T	C	8: 114,712,238	F348S	probably damaging	Het
Zeb2	T	A	2: 45,110,028	R65W	possibly damaging	Het
Zfp712	T	A	13: 67,040,573	H630L	probably damaging	Het
Zfp764	G	T	7: 127,405,436	H174Q	probably damaging	Het

Other mutations in Ncapg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01410:Ncapg2	APN	12	116424650	missense	possibly damaging	0.54
IGL01694:Ncapg2	APN	12	116407230	utr 5 prime	probably benign
IGL01724:Ncapg2	APN	12	116426711	missense	probably damaging	1.00
IGL01792:Ncapg2	APN	12	116425818	missense	probably damaging	0.99
IGL02098:Ncapg2	APN	12	116444332	missense	possibly damaging	0.59
IGL02136:Ncapg2	APN	12	116460583	missense	probably benign
IGL02409:Ncapg2	APN	12	116420717	missense	probably damaging	1.00
IGL02580:Ncapg2	APN	12	116420689	missense	probably damaging	1.00
IGL02653:Ncapg2	APN	12	116425906	critical splice donor site	probably null
IGL03073:Ncapg2	APN	12	116452274	missense	probably benign	0.01
IGL03114:Ncapg2	APN	12	116452373	splice site	probably benign
IGL03199:Ncapg2	APN	12	116419236	missense	probably damaging	1.00
IGL03328:Ncapg2	APN	12	116440057	missense	possibly damaging	0.90
P0033:Ncapg2	UTSW	12	116438635	missense	probably benign	0.03
R0008:Ncapg2	UTSW	12	116429835	missense	probably damaging	1.00
R0194:Ncapg2	UTSW	12	116420683	splice site	probably null
R0379:Ncapg2	UTSW	12	116443075	missense	probably damaging	1.00
R0568:Ncapg2	UTSW	12	116423215	missense	probably damaging	1.00
R0771:Ncapg2	UTSW	12	116413159	nonsense	probably null
R1016:Ncapg2	UTSW	12	116438675	missense	probably damaging	1.00
R1507:Ncapg2	UTSW	12	116460566	missense	probably benign	0.00
R1524:Ncapg2	UTSW	12	116434578	splice site	probably benign
R1596:Ncapg2	UTSW	12	116419236	missense	probably damaging	1.00
R1635:Ncapg2	UTSW	12	116434685	frame shift	probably null
R1752:Ncapg2	UTSW	12	116426718	missense	probably damaging	1.00
R2164:Ncapg2	UTSW	12	116450475	splice site	probably null
R2266:Ncapg2	UTSW	12	116429676	missense	probably damaging	1.00
R2366:Ncapg2	UTSW	12	116420729	nonsense	probably null
R2924:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R2925:Ncapg2	UTSW	12	116438729	missense	probably benign	0.03
R3828:Ncapg2	UTSW	12	116407318	splice site	probably benign
R3829:Ncapg2	UTSW	12	116407318	splice site	probably benign
R4384:Ncapg2	UTSW	12	116439877	critical splice donor site	probably null
R4651:Ncapg2	UTSW	12	116425787	missense	probably damaging	1.00
R4701:Ncapg2	UTSW	12	116440618	missense	probably benign
R4821:Ncapg2	UTSW	12	116415457	missense	probably damaging	0.99
R4845:Ncapg2	UTSW	12	116440588	missense	probably damaging	0.96
R5135:Ncapg2	UTSW	12	116427786	missense	possibly damaging	0.64
R5294:Ncapg2	UTSW	12	116427794	missense	possibly damaging	0.54
R5334:Ncapg2	UTSW	12	116426637	missense	probably damaging	1.00
R5588:Ncapg2	UTSW	12	116413077	missense	possibly damaging	0.95
R5888:Ncapg2	UTSW	12	116425800	missense	possibly damaging	0.84
R5938:Ncapg2	UTSW	12	116429657	missense	probably damaging	1.00
R5978:Ncapg2	UTSW	12	116424671	missense	possibly damaging	0.68
R6016:Ncapg2	UTSW	12	116426607	missense	probably damaging	1.00
R6026:Ncapg2	UTSW	12	116443021	missense	possibly damaging	0.73
R6155:Ncapg2	UTSW	12	116438011	missense	possibly damaging	0.83
R6509:Ncapg2	UTSW	12	116427756	missense	probably damaging	1.00
R6675:Ncapg2	UTSW	12	116434661	missense	possibly damaging	0.71
R6912:Ncapg2	UTSW	12	116426582	missense	probably benign
R7069:Ncapg2	UTSW	12	116424717	splice site	probably null
R7339:Ncapg2	UTSW	12	116414834	missense	probably damaging	0.96
R7440:Ncapg2	UTSW	12	116450413	missense	possibly damaging	0.89
R7445:Ncapg2	UTSW	12	116419268	missense	possibly damaging	0.50
R7704:Ncapg2	UTSW	12	116419277	missense	probably damaging	1.00
R8061:Ncapg2	UTSW	12	116426577	missense	probably benign
R8132:Ncapg2	UTSW	12	116444347	missense	possibly damaging	0.93
R8166:Ncapg2	UTSW	12	116412416	missense	probably benign	0.00
R8351:Ncapg2	UTSW	12	116440027	missense	possibly damaging	0.80
R8526:Ncapg2	UTSW	12	116440059	missense	probably benign	0.00
R8692:Ncapg2	UTSW	12	116450429	missense	probably damaging	1.00
R8739:Ncapg2	UTSW	12	116415478	missense	possibly damaging	0.75
R8766:Ncapg2	UTSW	12	116426736	missense	probably damaging	1.00
R8929:Ncapg2	UTSW	12	116452363	missense	probably damaging	1.00
R9046:Ncapg2	UTSW	12	116412525	missense	probably benign	0.01
R9344:Ncapg2	UTSW	12	116424653	missense	probably damaging	1.00
R9444:Ncapg2	UTSW	12	116407243	missense	probably damaging	1.00
R9580:Ncapg2	UTSW	12	116460608	missense	not run
X0020:Ncapg2	UTSW	12	116424707	missense	probably damaging	1.00
Z1177:Ncapg2	UTSW	12	116438605	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATGGTGGAACAAGTACCAGTG -3'
(R):5'- CCACTTTCCGTTTAGAGGCC -3'

Sequencing Primer
(F):5'- TACCAGTGTAACTATGAGGCCTG -3'
(R):5'- TCCGTTTAGAGGCCAAGTTAC -3'

Posted On

2022-02-07