Incidental Mutation 'R9187:Ncapg2'
ID 697466
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Name non-SMC condensin II complex, subunit G2
Synonyms Luzp5, 5830426I05Rik, mCAP-G2, Mtb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9187 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116405402-116463731 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116438667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 706 (D706E)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
AlphaFold Q6DFV1
Predicted Effect probably damaging
Transcript: ENSMUST00000084828
AA Change: D706E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: D706E

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,310,135 probably null Het
Abcb1a T A 5: 8,715,016 C669S probably benign Het
Abcc3 A G 11: 94,365,087 L524P probably damaging Het
Akap5 A T 12: 76,329,971 K726* probably null Het
Aldh16a1 T C 7: 45,142,017 E778G probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Apon A G 10: 128,254,963 N170S probably benign Het
Baiap2l1 T C 5: 144,280,954 Y274C probably benign Het
Bub1 A T 2: 127,814,936 N425K possibly damaging Het
Camsap1 A G 2: 25,930,016 C1487R probably damaging Het
Cd4 A C 6: 124,867,688 V378G probably damaging Het
Cenpa C A 5: 30,667,036 P3Q unknown Het
Cfap65 T A 1: 74,917,358 M1021L probably benign Het
Ddx39 G T 8: 83,722,484 M300I probably benign Het
Dgkh T C 14: 78,595,161 R819G probably damaging Het
Dlc1 A T 8: 36,938,632 M1K probably null Het
Dnah9 A G 11: 66,005,146 W2468R probably benign Het
Ebag9 A T 15: 44,640,310 K177I probably damaging Het
Ehbp1 T C 11: 22,151,184 I249V probably damaging Het
Fam171b T C 2: 83,880,021 V679A probably damaging Het
Gabbr2 G A 4: 46,674,533 T818I probably damaging Het
Gcn1l1 T C 5: 115,614,118 S2098P probably damaging Het
Glb1 T C 9: 114,473,923 I609T probably damaging Het
Gm12355 A G 11: 98,625,361 V62A possibly damaging Het
Gm5916 T G 9: 36,120,724 H88P probably benign Het
Gm6205 T C 5: 94,683,896 V254A probably benign Het
Gon4l T C 3: 88,879,311 S586P probably benign Het
Gzmg T A 14: 56,157,257 T185S probably benign Het
Hipk3 T A 2: 104,446,591 D381V probably damaging Het
Hnrnpul2 C A 19: 8,830,955 N681K probably benign Het
Hpdl C A 4: 116,821,175 G30C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Krt82 C A 15: 101,541,825 V479L probably benign Het
Lama4 G A 10: 39,048,128 probably null Het
Lamc1 C A 1: 153,221,688 E1537* probably null Het
Mab21l3 G A 3: 101,823,278 T215M probably benign Het
Magi3 C A 3: 104,015,757 V1215F possibly damaging Het
Mical2 T A 7: 112,303,590 C89* probably null Het
Mitf T A 6: 98,017,874 V427D probably benign Het
Muc4 T C 16: 32,768,728 V753A Het
Myo16 G A 8: 10,442,233 R725H unknown Het
Ndst1 T C 18: 60,691,196 D803G probably benign Het
Neb A T 2: 52,206,103 V5065D probably damaging Het
Npm3 G A 19: 45,749,502 R19* probably null Het
Ntrk3 A C 7: 78,247,218 N690K possibly damaging Het
Olfr850 T C 9: 19,477,870 I127V probably benign Het
Olfr855 T C 9: 19,584,654 I39T probably benign Het
Olfr985 C A 9: 40,127,590 V124L possibly damaging Het
P3h2 G A 16: 26,105,436 A83V probably benign Het
Pdia2 A G 17: 26,196,936 S362P probably damaging Het
Pmp22 C T 11: 63,134,442 H34Y probably benign Het
Pmp22 T C 11: 63,134,491 V50A probably benign Het
Ppfia4 T C 1: 134,327,268 D283G probably damaging Het
Prss55 T A 14: 64,077,082 Q213L probably null Het
Rgsl1 C T 1: 153,793,867 E258K possibly damaging Het
Ripor2 T C 13: 24,713,649 F777L probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Sgce G A 6: 4,711,362 R173C probably benign Het
Sncaip T G 18: 52,906,939 M735R probably benign Het
Snrpd2 T A 7: 19,152,580 I96N probably damaging Het
Spryd3 T G 15: 102,130,675 D121A probably damaging Het
Sspo T C 6: 48,495,289 C149R probably damaging Het
Tbc1d10b A T 7: 127,207,933 M144K probably benign Het
Tbc1d31 T A 15: 57,916,089 I66N probably damaging Het
Tssk1 A G 16: 17,894,593 T81A possibly damaging Het
Ttc28 A G 5: 111,102,036 Y284C probably damaging Het
Ttn T C 2: 76,743,411 T25713A probably benign Het
Vmn2r125 T C 4: 156,351,259 W311R probably damaging Het
Vmn2r80 A T 10: 79,194,604 T755S probably benign Het
Vmn2r98 T C 17: 19,081,219 C828R probably damaging Het
Wwox T C 8: 114,712,238 F348S probably damaging Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp712 T A 13: 67,040,573 H630L probably damaging Het
Zfp764 G T 7: 127,405,436 H174Q probably damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
R8351:Ncapg2 UTSW 12 116440027 missense possibly damaging 0.80
R8526:Ncapg2 UTSW 12 116440059 missense probably benign 0.00
R8692:Ncapg2 UTSW 12 116450429 missense probably damaging 1.00
R8739:Ncapg2 UTSW 12 116415478 missense possibly damaging 0.75
R8766:Ncapg2 UTSW 12 116426736 missense probably damaging 1.00
R8929:Ncapg2 UTSW 12 116452363 missense probably damaging 1.00
R9046:Ncapg2 UTSW 12 116412525 missense probably benign 0.01
R9344:Ncapg2 UTSW 12 116424653 missense probably damaging 1.00
R9444:Ncapg2 UTSW 12 116407243 missense probably damaging 1.00
R9580:Ncapg2 UTSW 12 116460608 missense not run
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGTGGAACAAGTACCAGTG -3'
(R):5'- CCACTTTCCGTTTAGAGGCC -3'

Sequencing Primer
(F):5'- TACCAGTGTAACTATGAGGCCTG -3'
(R):5'- TCCGTTTAGAGGCCAAGTTAC -3'
Posted On 2022-02-07