Mutagenetix > Incidental Mutations

Incidental Mutation 'R9187:Ndst1'

697483

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9187 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60691196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 803 (D803G)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably benign
Transcript: ENSMUST00000169273
AA Change: D803G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: D803G

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,310,135		probably null	Het
Abcb1a	T	A	5: 8,715,016	C669S	probably benign	Het
Abcc3	A	G	11: 94,365,087	L524P	probably damaging	Het
Akap5	A	T	12: 76,329,971	K726*	probably null	Het
Aldh16a1	T	C	7: 45,142,017	E778G	probably damaging	Het
Ankle2	G	A	5: 110,252,744	V649M	possibly damaging	Het
Apon	A	G	10: 128,254,963	N170S	probably benign	Het
Baiap2l1	T	C	5: 144,280,954	Y274C	probably benign	Het
Bub1	A	T	2: 127,814,936	N425K	possibly damaging	Het
Camsap1	A	G	2: 25,930,016	C1487R	probably damaging	Het
Cd4	A	C	6: 124,867,688	V378G	probably damaging	Het
Cenpa	C	A	5: 30,667,036	P3Q	unknown	Het
Cfap65	T	A	1: 74,917,358	M1021L	probably benign	Het
Ddx39	G	T	8: 83,722,484	M300I	probably benign	Het
Dgkh	T	C	14: 78,595,161	R819G	probably damaging	Het
Dlc1	A	T	8: 36,938,632	M1K	probably null	Het
Dnah9	A	G	11: 66,005,146	W2468R	probably benign	Het
Ebag9	A	T	15: 44,640,310	K177I	probably damaging	Het
Ehbp1	T	C	11: 22,151,184	I249V	probably damaging	Het
Fam171b	T	C	2: 83,880,021	V679A	probably damaging	Het
Gabbr2	G	A	4: 46,674,533	T818I	probably damaging	Het
Gcn1l1	T	C	5: 115,614,118	S2098P	probably damaging	Het
Glb1	T	C	9: 114,473,923	I609T	probably damaging	Het
Gm12355	A	G	11: 98,625,361	V62A	possibly damaging	Het
Gm5916	T	G	9: 36,120,724	H88P	probably benign	Het
Gm6205	T	C	5: 94,683,896	V254A	probably benign	Het
Gon4l	T	C	3: 88,879,311	S586P	probably benign	Het
Gzmg	T	A	14: 56,157,257	T185S	probably benign	Het
Hipk3	T	A	2: 104,446,591	D381V	probably damaging	Het
Hnrnpul2	C	A	19: 8,830,955	N681K	probably benign	Het
Hpdl	C	A	4: 116,821,175	G30C	probably damaging	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Krt82	C	A	15: 101,541,825	V479L	probably benign	Het
Lama4	G	A	10: 39,048,128		probably null	Het
Lamc1	C	A	1: 153,221,688	E1537*	probably null	Het
Mab21l3	G	A	3: 101,823,278	T215M	probably benign	Het
Magi3	C	A	3: 104,015,757	V1215F	possibly damaging	Het
Mical2	T	A	7: 112,303,590	C89*	probably null	Het
Mitf	T	A	6: 98,017,874	V427D	probably benign	Het
Muc4	T	C	16: 32,768,728	V753A		Het
Myo16	G	A	8: 10,442,233	R725H	unknown	Het
Ncapg2	T	A	12: 116,438,667	D706E	probably damaging	Het
Neb	A	T	2: 52,206,103	V5065D	probably damaging	Het
Npm3	G	A	19: 45,749,502	R19*	probably null	Het
Ntrk3	A	C	7: 78,247,218	N690K	possibly damaging	Het
Olfr850	T	C	9: 19,477,870	I127V	probably benign	Het
Olfr855	T	C	9: 19,584,654	I39T	probably benign	Het
Olfr985	C	A	9: 40,127,590	V124L	possibly damaging	Het
P3h2	G	A	16: 26,105,436	A83V	probably benign	Het
Pdia2	A	G	17: 26,196,936	S362P	probably damaging	Het
Pmp22	C	T	11: 63,134,442	H34Y	probably benign	Het
Pmp22	T	C	11: 63,134,491	V50A	probably benign	Het
Ppfia4	T	C	1: 134,327,268	D283G	probably damaging	Het
Prss55	T	A	14: 64,077,082	Q213L	probably null	Het
Rgsl1	C	T	1: 153,793,867	E258K	possibly damaging	Het
Ripor2	T	C	13: 24,713,649	F777L	probably benign	Het
Rsf1	GGC	GGCGGCGGCCGC	7: 97,579,933		probably benign	Het
Sgce	G	A	6: 4,711,362	R173C	probably benign	Het
Sncaip	T	G	18: 52,906,939	M735R	probably benign	Het
Snrpd2	T	A	7: 19,152,580	I96N	probably damaging	Het
Spryd3	T	G	15: 102,130,675	D121A	probably damaging	Het
Sspo	T	C	6: 48,495,289	C149R	probably damaging	Het
Tbc1d10b	A	T	7: 127,207,933	M144K	probably benign	Het
Tbc1d31	T	A	15: 57,916,089	I66N	probably damaging	Het
Tssk1	A	G	16: 17,894,593	T81A	possibly damaging	Het
Ttc28	A	G	5: 111,102,036	Y284C	probably damaging	Het
Ttn	T	C	2: 76,743,411	T25713A	probably benign	Het
Vmn2r125	T	C	4: 156,351,259	W311R	probably damaging	Het
Vmn2r80	A	T	10: 79,194,604	T755S	probably benign	Het
Vmn2r98	T	C	17: 19,081,219	C828R	probably damaging	Het
Wwox	T	C	8: 114,712,238	F348S	probably damaging	Het
Zeb2	T	A	2: 45,110,028	R65W	possibly damaging	Het
Zfp712	T	A	13: 67,040,573	H630L	probably damaging	Het
Zfp764	G	T	7: 127,405,436	H174Q	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCAAAGCTTTACTTCCATG -3'
(R):5'- TTACAGCCAGGCTATTCTTGC -3'

Sequencing Primer
(F):5'- CCAAAGCTTTACTTCCATGGCTGAAG -3'
(R):5'- GCCAGGCTATTCTTGCTGCAG -3'

Posted On

2022-02-07