Incidental Mutation 'R9187:Ndst1'
ID 697483
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene Name N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9187 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 60685978-60713389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60691196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 803 (D803G)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
AlphaFold Q3UHN9
Predicted Effect probably benign
Transcript: ENSMUST00000169273
AA Change: D803G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: D803G

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,310,135 probably null Het
Abcb1a T A 5: 8,715,016 C669S probably benign Het
Abcc3 A G 11: 94,365,087 L524P probably damaging Het
Akap5 A T 12: 76,329,971 K726* probably null Het
Aldh16a1 T C 7: 45,142,017 E778G probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Apon A G 10: 128,254,963 N170S probably benign Het
Baiap2l1 T C 5: 144,280,954 Y274C probably benign Het
Bub1 A T 2: 127,814,936 N425K possibly damaging Het
Camsap1 A G 2: 25,930,016 C1487R probably damaging Het
Cd4 A C 6: 124,867,688 V378G probably damaging Het
Cenpa C A 5: 30,667,036 P3Q unknown Het
Cfap65 T A 1: 74,917,358 M1021L probably benign Het
Ddx39 G T 8: 83,722,484 M300I probably benign Het
Dgkh T C 14: 78,595,161 R819G probably damaging Het
Dlc1 A T 8: 36,938,632 M1K probably null Het
Dnah9 A G 11: 66,005,146 W2468R probably benign Het
Ebag9 A T 15: 44,640,310 K177I probably damaging Het
Ehbp1 T C 11: 22,151,184 I249V probably damaging Het
Fam171b T C 2: 83,880,021 V679A probably damaging Het
Gabbr2 G A 4: 46,674,533 T818I probably damaging Het
Gcn1l1 T C 5: 115,614,118 S2098P probably damaging Het
Glb1 T C 9: 114,473,923 I609T probably damaging Het
Gm12355 A G 11: 98,625,361 V62A possibly damaging Het
Gm5916 T G 9: 36,120,724 H88P probably benign Het
Gm6205 T C 5: 94,683,896 V254A probably benign Het
Gon4l T C 3: 88,879,311 S586P probably benign Het
Gzmg T A 14: 56,157,257 T185S probably benign Het
Hipk3 T A 2: 104,446,591 D381V probably damaging Het
Hnrnpul2 C A 19: 8,830,955 N681K probably benign Het
Hpdl C A 4: 116,821,175 G30C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Krt82 C A 15: 101,541,825 V479L probably benign Het
Lama4 G A 10: 39,048,128 probably null Het
Lamc1 C A 1: 153,221,688 E1537* probably null Het
Mab21l3 G A 3: 101,823,278 T215M probably benign Het
Magi3 C A 3: 104,015,757 V1215F possibly damaging Het
Mical2 T A 7: 112,303,590 C89* probably null Het
Mitf T A 6: 98,017,874 V427D probably benign Het
Muc4 T C 16: 32,768,728 V753A Het
Myo16 G A 8: 10,442,233 R725H unknown Het
Ncapg2 T A 12: 116,438,667 D706E probably damaging Het
Neb A T 2: 52,206,103 V5065D probably damaging Het
Npm3 G A 19: 45,749,502 R19* probably null Het
Ntrk3 A C 7: 78,247,218 N690K possibly damaging Het
Olfr850 T C 9: 19,477,870 I127V probably benign Het
Olfr855 T C 9: 19,584,654 I39T probably benign Het
Olfr985 C A 9: 40,127,590 V124L possibly damaging Het
P3h2 G A 16: 26,105,436 A83V probably benign Het
Pdia2 A G 17: 26,196,936 S362P probably damaging Het
Pmp22 C T 11: 63,134,442 H34Y probably benign Het
Pmp22 T C 11: 63,134,491 V50A probably benign Het
Ppfia4 T C 1: 134,327,268 D283G probably damaging Het
Prss55 T A 14: 64,077,082 Q213L probably null Het
Rgsl1 C T 1: 153,793,867 E258K possibly damaging Het
Ripor2 T C 13: 24,713,649 F777L probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Sgce G A 6: 4,711,362 R173C probably benign Het
Sncaip T G 18: 52,906,939 M735R probably benign Het
Snrpd2 T A 7: 19,152,580 I96N probably damaging Het
Spryd3 T G 15: 102,130,675 D121A probably damaging Het
Sspo T C 6: 48,495,289 C149R probably damaging Het
Tbc1d10b A T 7: 127,207,933 M144K probably benign Het
Tbc1d31 T A 15: 57,916,089 I66N probably damaging Het
Tssk1 A G 16: 17,894,593 T81A possibly damaging Het
Ttc28 A G 5: 111,102,036 Y284C probably damaging Het
Ttn T C 2: 76,743,411 T25713A probably benign Het
Vmn2r125 T C 4: 156,351,259 W311R probably damaging Het
Vmn2r80 A T 10: 79,194,604 T755S probably benign Het
Vmn2r98 T C 17: 19,081,219 C828R probably damaging Het
Wwox T C 8: 114,712,238 F348S probably damaging Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp712 T A 13: 67,040,573 H630L probably damaging Het
Zfp764 G T 7: 127,405,436 H174Q probably damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
R8918:Ndst1 UTSW 18 60692011 missense probably benign 0.00
R8951:Ndst1 UTSW 18 60697124 missense probably benign
R9374:Ndst1 UTSW 18 60712859 missense probably damaging 0.97
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAAAGCTTTACTTCCATG -3'
(R):5'- TTACAGCCAGGCTATTCTTGC -3'

Sequencing Primer
(F):5'- CCAAAGCTTTACTTCCATGGCTGAAG -3'
(R):5'- GCCAGGCTATTCTTGCTGCAG -3'
Posted On 2022-02-07