Mutagenetix > Incidental Mutation

Incidental Mutation 'R9188:Otof'

697505

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

068980-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R9188 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30376751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1410 (V1410M)

Ref Sequence

ENSEMBL: ENSMUSP00000073803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074171
AA Change: V1410M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: V1410M

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114747
AA Change: V1405M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: V1405M

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	G	T	6: 83,162,248	R385L	probably benign	Het
Abca8b	A	T	11: 109,981,735	C13*	probably null	Het
Actc1	T	C	2: 114,050,498	D82G	probably damaging	Het
Adamts1	G	A	16: 85,802,683	R10C	probably damaging	Het
Ankle2	G	A	5: 110,252,744	V649M	possibly damaging	Het
Arhgap23	A	G	11: 97,500,157	I4V	possibly damaging	Het
Asic2	A	G	11: 81,151,912	F185S	probably benign	Het
Asmt	G	A	X: 170,677,850	E322K	probably damaging	Het
Caprin2	T	C	6: 148,865,924	D512G	probably benign	Het
Cltc	A	C	11: 86,737,166	I52S	probably damaging	Het
Cntn2	A	G	1: 132,515,538	L1040P	probably damaging	Het
Col12a1	T	C	9: 79,602,332	T3019A	probably benign	Het
Crisp4	A	T	1: 18,122,766	C242*	probably null	Het
Crocc	G	T	4: 141,019,840	N1716K	probably benign	Het
Cstf3	A	G	2: 104,608,878	E12G	possibly damaging	Het
Drc3	G	T	11: 60,358,789	V45F	probably damaging	Het
Etv4	A	G	11: 101,775,376	S108P	probably damaging	Het
Exosc10	T	A	4: 148,558,560	D31E	probably damaging	Het
F11	A	T	8: 45,245,699	D469E	probably benign	Het
Fzd7	A	G	1: 59,484,638	H560R	probably benign	Het
Gabrp	A	G	11: 33,567,252	I140T	possibly damaging	Het
Gna15	T	C	10: 81,507,964	T288A	probably benign	Het
Gucy2c	T	C	6: 136,723,758	D586G	probably benign	Het
H2-D1	T	C	17: 35,265,802	V213A	probably damaging	Het
Hsd3b1	A	T	3: 98,852,900	D258E	probably damaging	Het
Ier3	G	T	17: 35,821,887	G57W	probably damaging	Het
Ifnlr1	T	A	4: 135,698,860	C85S	probably damaging	Het
Ivd	G	T	2: 118,880,461	G384C	probably damaging	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Jak2	A	C	19: 29,310,953	D1068A	probably damaging	Het
Klk4	T	C	7: 43,885,373	I252T	probably damaging	Het
Klra17	A	T	6: 129,831,560	C237S	probably damaging	Het
Krtap1-3	T	C	11: 99,591,061	T87A	unknown	Het
Lbhd1	A	T	19: 8,887,033		probably null	Het
Lrig3	A	G	10: 126,003,066	R481G	possibly damaging	Het
Lrrc1	T	C	9: 77,455,205	Y247C	probably benign	Het
March1	T	A	8: 66,456,151	Y174*	probably null	Het
Mlxip	A	T	5: 123,445,579	T402S	probably benign	Het
Mmd2	T	C	5: 142,575,202	K93E	probably damaging	Het
Mmp27	A	G	9: 7,579,791	D422G	possibly damaging	Het
Mroh7	T	C	4: 106,709,592	I487V	probably benign	Het
Nectin2	A	G	7: 19,719,194		probably null	Het
Nfkbia	A	T	12: 55,490,473	L277H	probably damaging	Het
Olfr569	T	A	7: 102,887,389	I255F	possibly damaging	Het
Olfr722	T	C	14: 49,894,909	M298V	probably benign	Het
Pcdhb11	A	G	18: 37,423,135	N506S	probably damaging	Het
Pik3c2g	A	C	6: 139,622,403	E172D	possibly damaging	Het
Plch1	T	C	3: 63,731,654	D466G	probably null	Het
Plekha6	C	T	1: 133,292,433	R955W	probably damaging	Het
Ppm1d	T	A	11: 85,345,921	S509T	possibly damaging	Het
Prmt7	A	G	8: 106,234,854	D133G	probably damaging	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
Rfx6	A	G	10: 51,718,167	I394M	probably benign	Het
Rgl1	G	T	1: 152,519,171	N715K	probably damaging	Het
Rnf212	G	T	5: 108,774,945	S13*	probably null	Het
Rpgrip1l	T	C	8: 91,305,010	T80A	probably damaging	Het
Rsl1	G	T	13: 67,182,121	S211I	probably benign	Het
Serpinb9d	A	G	13: 33,202,860	M304V	probably damaging	Het
Sh3rf1	G	T	8: 61,361,773		probably null	Het
Snx16	C	A	3: 10,420,775	K261N	possibly damaging	Het
Srebf2	G	A	15: 82,182,156	R635Q	probably benign	Het
Styxl1	T	C	5: 135,765,818		probably null	Het
Tarbp2	A	G	15: 102,522,511	D233G	probably benign	Het
Tenm4	A	T	7: 96,772,027	N633Y	probably damaging	Het
Tgs1	T	C	4: 3,585,693	L190P	probably benign	Het
Tmem87a	C	T	2: 120,402,763	G55D	probably benign	Het
Ttn	A	T	2: 76,903,124	Y4602*	probably null	Het
Unc5b	A	T	10: 60,773,771	L582Q	probably damaging	Het
Wdpcp	A	G	11: 21,660,025	D31G	probably damaging	Het
Wdr78	T	C	4: 103,082,135	T77A		Het
Wrb	A	G	16: 96,154,163	D140G	probably benign	Het
Zbtb32	C	T	7: 30,591,895		probably benign	Het
Zfp936	C	T	7: 43,190,344	L412F	probably benign	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30382364	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30427551	missense	probably benign	0.22
R9748:Otof	UTSW	5	30383654	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30379232	missense	probably benign
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGAGCTTGTGGGGTCAATG -3'
(R):5'- TTTTCTACTTTGGGCCAGGC -3'

Sequencing Primer
(F):5'- TCAATGGCTGGGTCATGCTCC -3'
(R):5'- CAGGCCTGAAGGGACCAATG -3'

Posted On

2022-02-07