Incidental Mutation 'R9188:Otof'
ID 697505
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Name otoferlin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock # R9188 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30367062-30461932 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30376751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1410 (V1410M)
Ref Sequence ENSEMBL: ENSMUSP00000073803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074171
AA Change: V1410M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: V1410M

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114747
AA Change: V1405M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: V1405M

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,162,248 R385L probably benign Het
Abca8b A T 11: 109,981,735 C13* probably null Het
Actc1 T C 2: 114,050,498 D82G probably damaging Het
Adamts1 G A 16: 85,802,683 R10C probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arhgap23 A G 11: 97,500,157 I4V possibly damaging Het
Asic2 A G 11: 81,151,912 F185S probably benign Het
Asmt G A X: 170,677,850 E322K probably damaging Het
Caprin2 T C 6: 148,865,924 D512G probably benign Het
Cltc A C 11: 86,737,166 I52S probably damaging Het
Cntn2 A G 1: 132,515,538 L1040P probably damaging Het
Col12a1 T C 9: 79,602,332 T3019A probably benign Het
Crisp4 A T 1: 18,122,766 C242* probably null Het
Crocc G T 4: 141,019,840 N1716K probably benign Het
Cstf3 A G 2: 104,608,878 E12G possibly damaging Het
Drc3 G T 11: 60,358,789 V45F probably damaging Het
Etv4 A G 11: 101,775,376 S108P probably damaging Het
Exosc10 T A 4: 148,558,560 D31E probably damaging Het
F11 A T 8: 45,245,699 D469E probably benign Het
Fzd7 A G 1: 59,484,638 H560R probably benign Het
Gabrp A G 11: 33,567,252 I140T possibly damaging Het
Gna15 T C 10: 81,507,964 T288A probably benign Het
Gucy2c T C 6: 136,723,758 D586G probably benign Het
H2-D1 T C 17: 35,265,802 V213A probably damaging Het
Hsd3b1 A T 3: 98,852,900 D258E probably damaging Het
Ier3 G T 17: 35,821,887 G57W probably damaging Het
Ifnlr1 T A 4: 135,698,860 C85S probably damaging Het
Ivd G T 2: 118,880,461 G384C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Jak2 A C 19: 29,310,953 D1068A probably damaging Het
Klk4 T C 7: 43,885,373 I252T probably damaging Het
Klra17 A T 6: 129,831,560 C237S probably damaging Het
Krtap1-3 T C 11: 99,591,061 T87A unknown Het
Lbhd1 A T 19: 8,887,033 probably null Het
Lrig3 A G 10: 126,003,066 R481G possibly damaging Het
Lrrc1 T C 9: 77,455,205 Y247C probably benign Het
March1 T A 8: 66,456,151 Y174* probably null Het
Mlxip A T 5: 123,445,579 T402S probably benign Het
Mmd2 T C 5: 142,575,202 K93E probably damaging Het
Mmp27 A G 9: 7,579,791 D422G possibly damaging Het
Mroh7 T C 4: 106,709,592 I487V probably benign Het
Nectin2 A G 7: 19,719,194 probably null Het
Nfkbia A T 12: 55,490,473 L277H probably damaging Het
Olfr569 T A 7: 102,887,389 I255F possibly damaging Het
Olfr722 T C 14: 49,894,909 M298V probably benign Het
Pcdhb11 A G 18: 37,423,135 N506S probably damaging Het
Pik3c2g A C 6: 139,622,403 E172D possibly damaging Het
Plch1 T C 3: 63,731,654 D466G probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Ppm1d T A 11: 85,345,921 S509T possibly damaging Het
Prmt7 A G 8: 106,234,854 D133G probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Rfx6 A G 10: 51,718,167 I394M probably benign Het
Rgl1 G T 1: 152,519,171 N715K probably damaging Het
Rnf212 G T 5: 108,774,945 S13* probably null Het
Rpgrip1l T C 8: 91,305,010 T80A probably damaging Het
Rsl1 G T 13: 67,182,121 S211I probably benign Het
Serpinb9d A G 13: 33,202,860 M304V probably damaging Het
Sh3rf1 G T 8: 61,361,773 probably null Het
Snx16 C A 3: 10,420,775 K261N possibly damaging Het
Srebf2 G A 15: 82,182,156 R635Q probably benign Het
Tarbp2 A G 15: 102,522,511 D233G probably benign Het
Tenm4 A T 7: 96,772,027 N633Y probably damaging Het
Tgs1 T C 4: 3,585,693 L190P probably benign Het
Tmem87a C T 2: 120,402,763 G55D probably benign Het
Ttn A T 2: 76,903,124 Y4602* probably null Het
Unc5b A T 10: 60,773,771 L582Q probably damaging Het
Wdpcp A G 11: 21,660,025 D31G probably damaging Het
Wdr78 T C 4: 103,082,135 T77A Het
Wrb A G 16: 96,154,163 D140G probably benign Het
Zbtb32 C T 7: 30,591,895 probably benign Het
Zfp936 C T 7: 43,190,344 L412F probably benign Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
R7714:Otof UTSW 5 30370253 missense probably damaging 0.99
R8002:Otof UTSW 5 30380610 missense probably benign 0.10
R8032:Otof UTSW 5 30461798 start codon destroyed probably benign 0.07
R8153:Otof UTSW 5 30388735 missense probably damaging 1.00
R8158:Otof UTSW 5 30380194 missense probably benign 0.37
R8159:Otof UTSW 5 30380194 missense probably benign 0.37
R8441:Otof UTSW 5 30380856 missense probably damaging 0.99
R8738:Otof UTSW 5 30388624 nonsense probably null
R8813:Otof UTSW 5 30382898 missense probably benign 0.02
R8835:Otof UTSW 5 30370920 missense probably benign 0.44
R8852:Otof UTSW 5 30371700 missense possibly damaging 0.94
R8869:Otof UTSW 5 30420981 missense probably benign 0.08
R9029:Otof UTSW 5 30370075 critical splice donor site probably null
R9031:Otof UTSW 5 30380188 missense probably benign
R9061:Otof UTSW 5 30388657 missense possibly damaging 0.50
R9100:Otof UTSW 5 30382352 missense possibly damaging 0.80
R9121:Otof UTSW 5 30379118 missense probably benign 0.04
R9218:Otof UTSW 5 30385125 missense probably benign
R9280:Otof UTSW 5 30371550 missense probably damaging 0.98
R9395:Otof UTSW 5 30375632 missense probably damaging 1.00
R9400:Otof UTSW 5 30383519 critical splice donor site probably null
R9407:Otof UTSW 5 30380921 missense probably damaging 1.00
Z1176:Otof UTSW 5 30371586 missense probably damaging 0.98
Z1177:Otof UTSW 5 30376297 missense probably damaging 1.00
Z1177:Otof UTSW 5 30383658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGAGCTTGTGGGGTCAATG -3'
(R):5'- TTTTCTACTTTGGGCCAGGC -3'

Sequencing Primer
(F):5'- TCAATGGCTGGGTCATGCTCC -3'
(R):5'- CAGGCCTGAAGGGACCAATG -3'
Posted On 2022-02-07