Incidental Mutation 'R9188:Mmp27'
ID 697527
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 068980-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9188 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 7571397-7581886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7579792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 422 (D422G)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect possibly damaging
Transcript: ENSMUST00000120900
AA Change: D422G

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: D422G

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151853
AA Change: D448G

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: D448G

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: D366G

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,139,230 (GRCm39) R385L probably benign Het
Abca8b A T 11: 109,872,561 (GRCm39) C13* probably null Het
Actc1 T C 2: 113,880,979 (GRCm39) D82G probably damaging Het
Adamts1 G A 16: 85,599,571 (GRCm39) R10C probably damaging Het
Ankle2 G A 5: 110,400,610 (GRCm39) V649M possibly damaging Het
Arhgap23 A G 11: 97,390,983 (GRCm39) I4V possibly damaging Het
Asic2 A G 11: 81,042,738 (GRCm39) F185S probably benign Het
Asmt G A X: 169,111,583 (GRCm39) E322K probably damaging Het
Caprin2 T C 6: 148,767,422 (GRCm39) D512G probably benign Het
Cltc A C 11: 86,627,992 (GRCm39) I52S probably damaging Het
Cntn2 A G 1: 132,443,276 (GRCm39) L1040P probably damaging Het
Col12a1 T C 9: 79,509,614 (GRCm39) T3019A probably benign Het
Crisp4 A T 1: 18,192,990 (GRCm39) C242* probably null Het
Crocc G T 4: 140,747,151 (GRCm39) N1716K probably benign Het
Cstf3 A G 2: 104,439,223 (GRCm39) E12G possibly damaging Het
Dnai4 T C 4: 102,939,332 (GRCm39) T77A Het
Drc3 G T 11: 60,249,615 (GRCm39) V45F probably damaging Het
Etv4 A G 11: 101,666,202 (GRCm39) S108P probably damaging Het
Exosc10 T A 4: 148,643,017 (GRCm39) D31E probably damaging Het
F11 A T 8: 45,698,736 (GRCm39) D469E probably benign Het
Fzd7 A G 1: 59,523,797 (GRCm39) H560R probably benign Het
Gabrp A G 11: 33,517,252 (GRCm39) I140T possibly damaging Het
Get1 A G 16: 95,955,363 (GRCm39) D140G probably benign Het
Gna15 T C 10: 81,343,798 (GRCm39) T288A probably benign Het
Gucy2c T C 6: 136,700,756 (GRCm39) D586G probably benign Het
H2-D1 T C 17: 35,484,778 (GRCm39) V213A probably damaging Het
Hsd3b1 A T 3: 98,760,216 (GRCm39) D258E probably damaging Het
Ier3 G T 17: 36,132,779 (GRCm39) G57W probably damaging Het
Ifnlr1 T A 4: 135,426,171 (GRCm39) C85S probably damaging Het
Ivd G T 2: 118,710,942 (GRCm39) G384C probably damaging Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Jak2 A C 19: 29,288,353 (GRCm39) D1068A probably damaging Het
Klk4 T C 7: 43,534,797 (GRCm39) I252T probably damaging Het
Klra17 A T 6: 129,808,523 (GRCm39) C237S probably damaging Het
Krtap1-3 T C 11: 99,481,887 (GRCm39) T87A unknown Het
Lbhd1 A T 19: 8,864,397 (GRCm39) probably null Het
Lrig3 A G 10: 125,838,935 (GRCm39) R481G possibly damaging Het
Lrrc1 T C 9: 77,362,487 (GRCm39) Y247C probably benign Het
Marchf1 T A 8: 66,908,803 (GRCm39) Y174* probably null Het
Mlxip A T 5: 123,583,642 (GRCm39) T402S probably benign Het
Mmd2 T C 5: 142,560,957 (GRCm39) K93E probably damaging Het
Mroh7 T C 4: 106,566,789 (GRCm39) I487V probably benign Het
Nectin2 A G 7: 19,453,119 (GRCm39) probably null Het
Nfkbia A T 12: 55,537,258 (GRCm39) L277H probably damaging Het
Or4n5 T C 14: 50,132,366 (GRCm39) M298V probably benign Het
Or52r1 T A 7: 102,536,596 (GRCm39) I255F possibly damaging Het
Otof C T 5: 30,534,095 (GRCm39) V1410M probably damaging Het
Pcdhb11 A G 18: 37,556,188 (GRCm39) N506S probably damaging Het
Pik3c2g A C 6: 139,599,401 (GRCm39) E172D possibly damaging Het
Plch1 T C 3: 63,639,075 (GRCm39) D466G probably null Het
Plekha6 C T 1: 133,220,171 (GRCm39) R955W probably damaging Het
Ppm1d T A 11: 85,236,747 (GRCm39) S509T possibly damaging Het
Prmt7 A G 8: 106,961,486 (GRCm39) D133G probably damaging Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Rfx6 A G 10: 51,594,263 (GRCm39) I394M probably benign Het
Rgl1 G T 1: 152,394,922 (GRCm39) N715K probably damaging Het
Rnf212 G T 5: 108,922,811 (GRCm39) S13* probably null Het
Rpgrip1l T C 8: 92,031,638 (GRCm39) T80A probably damaging Het
Rsl1 G T 13: 67,330,185 (GRCm39) S211I probably benign Het
Serpinb9d A G 13: 33,386,843 (GRCm39) M304V probably damaging Het
Sh3rf1 G T 8: 61,814,807 (GRCm39) probably null Het
Snx16 C A 3: 10,485,835 (GRCm39) K261N possibly damaging Het
Srebf2 G A 15: 82,066,357 (GRCm39) R635Q probably benign Het
Styxl1 T C 5: 135,794,672 (GRCm39) probably null Het
Tarbp2 A G 15: 102,430,946 (GRCm39) D233G probably benign Het
Tenm4 A T 7: 96,421,234 (GRCm39) N633Y probably damaging Het
Tgs1 T C 4: 3,585,693 (GRCm39) L190P probably benign Het
Tmem87a C T 2: 120,233,244 (GRCm39) G55D probably benign Het
Ttn A T 2: 76,733,468 (GRCm39) Y4602* probably null Het
Unc5b A T 10: 60,609,550 (GRCm39) L582Q probably damaging Het
Wdpcp A G 11: 21,610,025 (GRCm39) D31G probably damaging Het
Zbtb32 C T 7: 30,291,320 (GRCm39) probably benign Het
Zfp936 C T 7: 42,839,768 (GRCm39) L412F probably benign Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7,573,505 (GRCm39) splice site probably benign
IGL00656:Mmp27 APN 9 7,581,383 (GRCm39) missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7,578,900 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7,573,416 (GRCm39) missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7,573,298 (GRCm39) missense probably benign 0.06
IGL01631:Mmp27 APN 9 7,573,289 (GRCm39) critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7,571,591 (GRCm39) missense probably benign 0.03
IGL03024:Mmp27 APN 9 7,581,377 (GRCm39) missense probably benign 0.17
R0662:Mmp27 UTSW 9 7,577,651 (GRCm39) missense probably benign 0.00
R0715:Mmp27 UTSW 9 7,581,156 (GRCm39) splice site probably benign
R0826:Mmp27 UTSW 9 7,579,010 (GRCm39) missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7,579,067 (GRCm39) splice site probably null
R1793:Mmp27 UTSW 9 7,571,459 (GRCm39) start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7,578,898 (GRCm39) splice site probably null
R2074:Mmp27 UTSW 9 7,577,740 (GRCm39) missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7,577,379 (GRCm39) nonsense probably null
R2445:Mmp27 UTSW 9 7,581,182 (GRCm39) missense probably benign 0.12
R2961:Mmp27 UTSW 9 7,573,603 (GRCm39) missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7,581,195 (GRCm39) missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R4938:Mmp27 UTSW 9 7,578,983 (GRCm39) missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7,579,001 (GRCm39) missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7,572,159 (GRCm39) missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7,581,369 (GRCm39) missense probably benign 0.00
R5446:Mmp27 UTSW 9 7,573,516 (GRCm39) splice site probably benign
R5485:Mmp27 UTSW 9 7,573,363 (GRCm39) missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7,579,063 (GRCm39) missense probably null 1.00
R6682:Mmp27 UTSW 9 7,573,606 (GRCm39) missense probably benign 0.02
R6712:Mmp27 UTSW 9 7,572,177 (GRCm39) missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7,571,955 (GRCm39) missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7,578,231 (GRCm39) missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7,577,318 (GRCm39) missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7,579,002 (GRCm39) missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7,578,985 (GRCm39) missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7,573,492 (GRCm39) missense unknown
R8537:Mmp27 UTSW 9 7,579,776 (GRCm39) missense probably benign 0.00
R9039:Mmp27 UTSW 9 7,581,250 (GRCm39) missense probably benign 0.01
R9087:Mmp27 UTSW 9 7,579,858 (GRCm39) missense probably damaging 1.00
R9280:Mmp27 UTSW 9 7,579,812 (GRCm39) missense probably benign 0.09
R9367:Mmp27 UTSW 9 7,573,550 (GRCm39) missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7,573,299 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGCATCTGAGCATACAAAC -3'
(R):5'- GTCTACAGGGGTAATGCCTAC -3'

Sequencing Primer
(F):5'- ACTGCGGTATCATAATCTCTACCATG -3'
(R):5'- GCCTACCAACCAAAGTATGTATTTG -3'
Posted On 2022-02-07