Incidental Mutation 'R9188:Mmp27'
ID 697527
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9188 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7579791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 422 (D422G)
Ref Sequence ENSEMBL: ENSMUSP00000113231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect possibly damaging
Transcript: ENSMUST00000120900
AA Change: D422G

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: D422G

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151853
AA Change: D448G

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: D448G

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: D366G

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,162,248 R385L probably benign Het
Abca8b A T 11: 109,981,735 C13* probably null Het
Actc1 T C 2: 114,050,498 D82G probably damaging Het
Adamts1 G A 16: 85,802,683 R10C probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arhgap23 A G 11: 97,500,157 I4V possibly damaging Het
Asic2 A G 11: 81,151,912 F185S probably benign Het
Asmt G A X: 170,677,850 E322K probably damaging Het
Caprin2 T C 6: 148,865,924 D512G probably benign Het
Cltc A C 11: 86,737,166 I52S probably damaging Het
Cntn2 A G 1: 132,515,538 L1040P probably damaging Het
Col12a1 T C 9: 79,602,332 T3019A probably benign Het
Crisp4 A T 1: 18,122,766 C242* probably null Het
Crocc G T 4: 141,019,840 N1716K probably benign Het
Cstf3 A G 2: 104,608,878 E12G possibly damaging Het
Drc3 G T 11: 60,358,789 V45F probably damaging Het
Etv4 A G 11: 101,775,376 S108P probably damaging Het
Exosc10 T A 4: 148,558,560 D31E probably damaging Het
F11 A T 8: 45,245,699 D469E probably benign Het
Fzd7 A G 1: 59,484,638 H560R probably benign Het
Gabrp A G 11: 33,567,252 I140T possibly damaging Het
Gna15 T C 10: 81,507,964 T288A probably benign Het
Gucy2c T C 6: 136,723,758 D586G probably benign Het
H2-D1 T C 17: 35,265,802 V213A probably damaging Het
Hsd3b1 A T 3: 98,852,900 D258E probably damaging Het
Ier3 G T 17: 35,821,887 G57W probably damaging Het
Ifnlr1 T A 4: 135,698,860 C85S probably damaging Het
Ivd G T 2: 118,880,461 G384C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Jak2 A C 19: 29,310,953 D1068A probably damaging Het
Klk4 T C 7: 43,885,373 I252T probably damaging Het
Klra17 A T 6: 129,831,560 C237S probably damaging Het
Krtap1-3 T C 11: 99,591,061 T87A unknown Het
Lbhd1 A T 19: 8,887,033 probably null Het
Lrig3 A G 10: 126,003,066 R481G possibly damaging Het
Lrrc1 T C 9: 77,455,205 Y247C probably benign Het
March1 T A 8: 66,456,151 Y174* probably null Het
Mlxip A T 5: 123,445,579 T402S probably benign Het
Mmd2 T C 5: 142,575,202 K93E probably damaging Het
Mroh7 T C 4: 106,709,592 I487V probably benign Het
Nectin2 A G 7: 19,719,194 probably null Het
Nfkbia A T 12: 55,490,473 L277H probably damaging Het
Olfr569 T A 7: 102,887,389 I255F possibly damaging Het
Olfr722 T C 14: 49,894,909 M298V probably benign Het
Otof C T 5: 30,376,751 V1410M probably damaging Het
Pcdhb11 A G 18: 37,423,135 N506S probably damaging Het
Pik3c2g A C 6: 139,622,403 E172D possibly damaging Het
Plch1 T C 3: 63,731,654 D466G probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Ppm1d T A 11: 85,345,921 S509T possibly damaging Het
Prmt7 A G 8: 106,234,854 D133G probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Rfx6 A G 10: 51,718,167 I394M probably benign Het
Rgl1 G T 1: 152,519,171 N715K probably damaging Het
Rnf212 G T 5: 108,774,945 S13* probably null Het
Rpgrip1l T C 8: 91,305,010 T80A probably damaging Het
Rsl1 G T 13: 67,182,121 S211I probably benign Het
Serpinb9d A G 13: 33,202,860 M304V probably damaging Het
Sh3rf1 G T 8: 61,361,773 probably null Het
Snx16 C A 3: 10,420,775 K261N possibly damaging Het
Srebf2 G A 15: 82,182,156 R635Q probably benign Het
Tarbp2 A G 15: 102,522,511 D233G probably benign Het
Tenm4 A T 7: 96,772,027 N633Y probably damaging Het
Tgs1 T C 4: 3,585,693 L190P probably benign Het
Tmem87a C T 2: 120,402,763 G55D probably benign Het
Ttn A T 2: 76,903,124 Y4602* probably null Het
Unc5b A T 10: 60,773,771 L582Q probably damaging Het
Wdpcp A G 11: 21,660,025 D31G probably damaging Het
Wdr78 T C 4: 103,082,135 T77A Het
Wrb A G 16: 96,154,163 D140G probably benign Het
Zbtb32 C T 7: 30,591,895 probably benign Het
Zfp936 C T 7: 43,190,344 L412F probably benign Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5485:Mmp27 UTSW 9 7573362 missense probably damaging 1.00
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7578984 missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7573491 missense unknown
R8537:Mmp27 UTSW 9 7579775 missense probably benign 0.00
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9087:Mmp27 UTSW 9 7579857 missense probably damaging 1.00
R9280:Mmp27 UTSW 9 7579811 missense probably benign 0.09
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGCATCTGAGCATACAAAC -3'
(R):5'- GTCTACAGGGGTAATGCCTAC -3'

Sequencing Primer
(F):5'- ACTGCGGTATCATAATCTCTACCATG -3'
(R):5'- GCCTACCAACCAAAGTATGTATTTG -3'
Posted On 2022-02-07