Incidental Mutation 'R9188:Gabrp'
ID 697535
Institutional Source Beutler Lab
Gene Symbol Gabrp
Ensembl Gene ENSMUSG00000020159
Gene Name gamma-aminobutyric acid (GABA) A receptor, pi
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9188 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 33550781-33578959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33567252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 140 (I140T)
Ref Sequence ENSEMBL: ENSMUSP00000020366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020366]
AlphaFold Q8QZW7
Predicted Effect possibly damaging
Transcript: ENSMUST00000020366
AA Change: I140T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: I140T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 242 1.3e-49 PFAM
Pfam:Neur_chan_memb 249 353 5.2e-23 PFAM
transmembrane domain 420 437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,162,248 R385L probably benign Het
Abca8b A T 11: 109,981,735 C13* probably null Het
Actc1 T C 2: 114,050,498 D82G probably damaging Het
Adamts1 G A 16: 85,802,683 R10C probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arhgap23 A G 11: 97,500,157 I4V possibly damaging Het
Asic2 A G 11: 81,151,912 F185S probably benign Het
Asmt G A X: 170,677,850 E322K probably damaging Het
Caprin2 T C 6: 148,865,924 D512G probably benign Het
Cltc A C 11: 86,737,166 I52S probably damaging Het
Cntn2 A G 1: 132,515,538 L1040P probably damaging Het
Col12a1 T C 9: 79,602,332 T3019A probably benign Het
Crisp4 A T 1: 18,122,766 C242* probably null Het
Crocc G T 4: 141,019,840 N1716K probably benign Het
Cstf3 A G 2: 104,608,878 E12G possibly damaging Het
Drc3 G T 11: 60,358,789 V45F probably damaging Het
Etv4 A G 11: 101,775,376 S108P probably damaging Het
Exosc10 T A 4: 148,558,560 D31E probably damaging Het
F11 A T 8: 45,245,699 D469E probably benign Het
Fzd7 A G 1: 59,484,638 H560R probably benign Het
Gna15 T C 10: 81,507,964 T288A probably benign Het
Gucy2c T C 6: 136,723,758 D586G probably benign Het
H2-D1 T C 17: 35,265,802 V213A probably damaging Het
Hsd3b1 A T 3: 98,852,900 D258E probably damaging Het
Ier3 G T 17: 35,821,887 G57W probably damaging Het
Ifnlr1 T A 4: 135,698,860 C85S probably damaging Het
Ivd G T 2: 118,880,461 G384C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Jak2 A C 19: 29,310,953 D1068A probably damaging Het
Klk4 T C 7: 43,885,373 I252T probably damaging Het
Klra17 A T 6: 129,831,560 C237S probably damaging Het
Krtap1-3 T C 11: 99,591,061 T87A unknown Het
Lbhd1 A T 19: 8,887,033 probably null Het
Lrig3 A G 10: 126,003,066 R481G possibly damaging Het
Lrrc1 T C 9: 77,455,205 Y247C probably benign Het
March1 T A 8: 66,456,151 Y174* probably null Het
Mlxip A T 5: 123,445,579 T402S probably benign Het
Mmd2 T C 5: 142,575,202 K93E probably damaging Het
Mmp27 A G 9: 7,579,791 D422G possibly damaging Het
Mroh7 T C 4: 106,709,592 I487V probably benign Het
Nectin2 A G 7: 19,719,194 probably null Het
Nfkbia A T 12: 55,490,473 L277H probably damaging Het
Olfr569 T A 7: 102,887,389 I255F possibly damaging Het
Olfr722 T C 14: 49,894,909 M298V probably benign Het
Otof C T 5: 30,376,751 V1410M probably damaging Het
Pcdhb11 A G 18: 37,423,135 N506S probably damaging Het
Pik3c2g A C 6: 139,622,403 E172D possibly damaging Het
Plch1 T C 3: 63,731,654 D466G probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Ppm1d T A 11: 85,345,921 S509T possibly damaging Het
Prmt7 A G 8: 106,234,854 D133G probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Rfx6 A G 10: 51,718,167 I394M probably benign Het
Rgl1 G T 1: 152,519,171 N715K probably damaging Het
Rnf212 G T 5: 108,774,945 S13* probably null Het
Rpgrip1l T C 8: 91,305,010 T80A probably damaging Het
Rsl1 G T 13: 67,182,121 S211I probably benign Het
Serpinb9d A G 13: 33,202,860 M304V probably damaging Het
Sh3rf1 G T 8: 61,361,773 probably null Het
Snx16 C A 3: 10,420,775 K261N possibly damaging Het
Srebf2 G A 15: 82,182,156 R635Q probably benign Het
Tarbp2 A G 15: 102,522,511 D233G probably benign Het
Tenm4 A T 7: 96,772,027 N633Y probably damaging Het
Tgs1 T C 4: 3,585,693 L190P probably benign Het
Tmem87a C T 2: 120,402,763 G55D probably benign Het
Ttn A T 2: 76,903,124 Y4602* probably null Het
Unc5b A T 10: 60,773,771 L582Q probably damaging Het
Wdpcp A G 11: 21,660,025 D31G probably damaging Het
Wdr78 T C 4: 103,082,135 T77A Het
Wrb A G 16: 96,154,163 D140G probably benign Het
Zbtb32 C T 7: 30,591,895 probably benign Het
Zfp936 C T 7: 43,190,344 L412F probably benign Het
Other mutations in Gabrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gabrp APN 11 33552644 missense possibly damaging 0.91
IGL01299:Gabrp APN 11 33554476 missense probably damaging 1.00
IGL01305:Gabrp APN 11 33555055 missense probably damaging 1.00
IGL01686:Gabrp APN 11 33552826 nonsense probably null
IGL01729:Gabrp APN 11 33552689 missense probably damaging 1.00
IGL03031:Gabrp APN 11 33554980 missense probably damaging 1.00
IGL03172:Gabrp APN 11 33554388 missense probably damaging 1.00
IGL03280:Gabrp APN 11 33552616 missense probably benign 0.12
ANU22:Gabrp UTSW 11 33555055 missense probably damaging 1.00
R0265:Gabrp UTSW 11 33552614 missense probably damaging 1.00
R0326:Gabrp UTSW 11 33554362 missense probably damaging 0.99
R1744:Gabrp UTSW 11 33572462 missense probably benign 0.03
R4174:Gabrp UTSW 11 33568092 missense probably damaging 1.00
R5043:Gabrp UTSW 11 33568072 missense probably benign 0.00
R5213:Gabrp UTSW 11 33567211 critical splice donor site probably null
R5290:Gabrp UTSW 11 33567310 missense probably damaging 0.99
R5665:Gabrp UTSW 11 33554308 missense possibly damaging 0.56
R6698:Gabrp UTSW 11 33557017 missense probably damaging 1.00
R8711:Gabrp UTSW 11 33555023 missense probably damaging 1.00
R8817:Gabrp UTSW 11 33554464 missense possibly damaging 0.77
Z1176:Gabrp UTSW 11 33552673 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAACCTAGCAGCTACTCAGTAGG -3'
(R):5'- ACTATATACCTCCGGCAGCG -3'

Sequencing Primer
(F):5'- GCAGCTACTCAGTAGGTACATTTG -3'
(R):5'- AGCGTTGGACAGACCCAC -3'
Posted On 2022-02-07