Incidental Mutation 'R9188:Ppm1d'
ID 697538
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9188 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85345921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 509 (S509T)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835]
AlphaFold Q9QZ67
Predicted Effect possibly damaging
Transcript: ENSMUST00000020835
AA Change: S509T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: S509T

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik G T 6: 83,162,248 R385L probably benign Het
Abca8b A T 11: 109,981,735 C13* probably null Het
Actc1 T C 2: 114,050,498 D82G probably damaging Het
Adamts1 G A 16: 85,802,683 R10C probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Arhgap23 A G 11: 97,500,157 I4V possibly damaging Het
Asic2 A G 11: 81,151,912 F185S probably benign Het
Asmt G A X: 170,677,850 E322K probably damaging Het
Caprin2 T C 6: 148,865,924 D512G probably benign Het
Cltc A C 11: 86,737,166 I52S probably damaging Het
Cntn2 A G 1: 132,515,538 L1040P probably damaging Het
Col12a1 T C 9: 79,602,332 T3019A probably benign Het
Crisp4 A T 1: 18,122,766 C242* probably null Het
Crocc G T 4: 141,019,840 N1716K probably benign Het
Cstf3 A G 2: 104,608,878 E12G possibly damaging Het
Drc3 G T 11: 60,358,789 V45F probably damaging Het
Etv4 A G 11: 101,775,376 S108P probably damaging Het
Exosc10 T A 4: 148,558,560 D31E probably damaging Het
F11 A T 8: 45,245,699 D469E probably benign Het
Fzd7 A G 1: 59,484,638 H560R probably benign Het
Gabrp A G 11: 33,567,252 I140T possibly damaging Het
Gna15 T C 10: 81,507,964 T288A probably benign Het
Gucy2c T C 6: 136,723,758 D586G probably benign Het
H2-D1 T C 17: 35,265,802 V213A probably damaging Het
Hsd3b1 A T 3: 98,852,900 D258E probably damaging Het
Ier3 G T 17: 35,821,887 G57W probably damaging Het
Ifnlr1 T A 4: 135,698,860 C85S probably damaging Het
Ivd G T 2: 118,880,461 G384C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Jak2 A C 19: 29,310,953 D1068A probably damaging Het
Klk4 T C 7: 43,885,373 I252T probably damaging Het
Klra17 A T 6: 129,831,560 C237S probably damaging Het
Krtap1-3 T C 11: 99,591,061 T87A unknown Het
Lbhd1 A T 19: 8,887,033 probably null Het
Lrig3 A G 10: 126,003,066 R481G possibly damaging Het
Lrrc1 T C 9: 77,455,205 Y247C probably benign Het
March1 T A 8: 66,456,151 Y174* probably null Het
Mlxip A T 5: 123,445,579 T402S probably benign Het
Mmd2 T C 5: 142,575,202 K93E probably damaging Het
Mmp27 A G 9: 7,579,791 D422G possibly damaging Het
Mroh7 T C 4: 106,709,592 I487V probably benign Het
Nectin2 A G 7: 19,719,194 probably null Het
Nfkbia A T 12: 55,490,473 L277H probably damaging Het
Olfr569 T A 7: 102,887,389 I255F possibly damaging Het
Olfr722 T C 14: 49,894,909 M298V probably benign Het
Otof C T 5: 30,376,751 V1410M probably damaging Het
Pcdhb11 A G 18: 37,423,135 N506S probably damaging Het
Pik3c2g A C 6: 139,622,403 E172D possibly damaging Het
Plch1 T C 3: 63,731,654 D466G probably null Het
Plekha6 C T 1: 133,292,433 R955W probably damaging Het
Prmt7 A G 8: 106,234,854 D133G probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Rfx6 A G 10: 51,718,167 I394M probably benign Het
Rgl1 G T 1: 152,519,171 N715K probably damaging Het
Rnf212 G T 5: 108,774,945 S13* probably null Het
Rpgrip1l T C 8: 91,305,010 T80A probably damaging Het
Rsl1 G T 13: 67,182,121 S211I probably benign Het
Serpinb9d A G 13: 33,202,860 M304V probably damaging Het
Sh3rf1 G T 8: 61,361,773 probably null Het
Snx16 C A 3: 10,420,775 K261N possibly damaging Het
Srebf2 G A 15: 82,182,156 R635Q probably benign Het
Tarbp2 A G 15: 102,522,511 D233G probably benign Het
Tenm4 A T 7: 96,772,027 N633Y probably damaging Het
Tgs1 T C 4: 3,585,693 L190P probably benign Het
Tmem87a C T 2: 120,402,763 G55D probably benign Het
Ttn A T 2: 76,903,124 Y4602* probably null Het
Unc5b A T 10: 60,773,771 L582Q probably damaging Het
Wdpcp A G 11: 21,660,025 D31G probably damaging Het
Wdr78 T C 4: 103,082,135 T77A Het
Wrb A G 16: 96,154,163 D140G probably benign Het
Zbtb32 C T 7: 30,591,895 probably benign Het
Zfp936 C T 7: 43,190,344 L412F probably benign Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCAGTAATGCCTTCTCAG -3'
(R):5'- CAGTTTGACAGAGTGCCTGC -3'

Sequencing Primer
(F):5'- CTCAGAGAAGTTTTTAGAGGTCCCAG -3'
(R):5'- AGTGCCTGCGCTGGGATG -3'
Posted On 2022-02-07