Incidental Mutation 'R9189:Slc9a2'
ID 697560
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9189 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 40680574-40769273 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 40755784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 502 (E502K)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231]
AlphaFold Q3ZAS0
Predicted Effect probably benign
Transcript: ENSMUST00000027231
AA Change: E502K

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: E502K

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T A 11: 116,174,405 D608V probably damaging Het
Actg1 A T 11: 120,348,187 C26S unknown Het
Ahnak T A 19: 9,010,883 V3177E possibly damaging Het
Akap11 G A 14: 78,513,498 T483I Het
Akr1cl A G 1: 65,024,671 S120P probably benign Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Ankrd55 A T 13: 112,368,036 I439F probably damaging Het
Asb8 A G 15: 98,142,754 M9T possibly damaging Het
Ascc1 A T 10: 60,007,823 Y69F probably benign Het
Atp9a A T 2: 168,676,140 probably null Het
Cd8b1 T C 6: 71,329,768 F160L probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cep250 A G 2: 155,976,430 T842A probably benign Het
Cgnl1 T A 9: 71,723,565 K552* probably null Het
Cntnap4 C T 8: 112,875,968 T1227M possibly damaging Het
Cobll1 C A 2: 65,150,989 V86F probably damaging Het
Dchs2 A G 3: 83,348,254 N2419S probably damaging Het
Dhx30 A T 9: 110,085,426 L1001* probably null Het
Diaph1 C T 18: 37,891,109 V559M unknown Het
Dis3l A T 9: 64,310,449 H783Q probably benign Het
Dock7 T G 4: 98,989,113 T1063P unknown Het
Dsc1 T C 18: 20,099,157 T265A possibly damaging Het
Eif2ak4 A T 2: 118,427,912 Q581L probably damaging Het
Eprs A T 1: 185,374,137 D183V possibly damaging Het
Fads2 G C 19: 10,091,819 D80E probably benign Het
Fam167b G A 4: 129,577,082 R158C probably damaging Het
Fam71a G A 1: 191,162,703 T581I possibly damaging Het
Flnb T A 14: 7,892,976 I682K possibly damaging Het
Gpatch2l C T 12: 86,244,378 P112S probably benign Het
Gpn1 T A 5: 31,497,366 H87Q unknown Het
Greb1l T C 18: 10,499,983 V350A probably benign Het
Grm5 A T 7: 88,074,816 K771N probably damaging Het
Gucy2c C T 6: 136,751,047 S319N probably benign Het
Hcfc2 G T 10: 82,699,207 A22S probably benign Het
Hist1h2bg A G 13: 23,571,587 D52G probably damaging Het
Hnf4a A G 2: 163,551,577 D39G probably benign Het
Il6st C T 13: 112,498,806 T584M probably damaging Het
Irf3 T A 7: 45,000,822 V254E possibly damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kank4 T A 4: 98,780,052 K53* probably null Het
Kcnj11 A T 7: 46,098,752 F382L possibly damaging Het
Kcnq3 T C 15: 65,995,661 Y711C probably damaging Het
Kctd3 A G 1: 188,972,439 S712P possibly damaging Het
Krt20 A G 11: 99,432,261 I245T possibly damaging Het
Larp1b T C 3: 40,970,604 I219T probably damaging Het
Lman2l A G 1: 36,439,690 F114L probably damaging Het
Loxl2 T A 14: 69,692,410 Y746N possibly damaging Het
Lrrc43 T C 5: 123,508,046 S628P probably benign Het
Mroh8 A C 2: 157,269,625 D136E probably damaging Het
Nek8 T A 11: 78,172,516 M141L probably benign Het
Nr2e1 C A 10: 42,578,272 R22L probably damaging Het
Nr6a1 C T 2: 38,926,117 probably null Het
Olfr1164 A G 2: 88,093,850 F29L probably damaging Het
Olfr1167 T C 2: 88,149,564 M152V probably benign Het
Olfr1377 T A 11: 50,985,339 C213S probably damaging Het
Olfr3 T A 2: 36,812,202 M297L possibly damaging Het
Onecut2 A G 18: 64,340,819 Y147C probably damaging Het
Pcdhac2 T C 18: 37,144,263 F99L probably benign Het
Pcdhga2 T G 18: 37,669,742 V213G possibly damaging Het
Pgap1 A T 1: 54,480,749 V909E probably benign Het
Pik3r4 A T 9: 105,669,839 T939S probably benign Het
Pip4k2c T C 10: 127,199,377 D374G possibly damaging Het
Plxdc1 A T 11: 97,953,962 D252E probably benign Het
Pm20d1 A C 1: 131,802,377 D218A probably damaging Het
Polq C A 16: 37,044,903 Q706K probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss41 A T 17: 23,842,387 H143Q probably damaging Het
Ptpn21 A G 12: 98,689,002 Y569H probably damaging Het
Rad17 T C 13: 100,637,056 K142E probably damaging Het
Rcan3 T C 4: 135,425,296 E38G probably benign Het
Rgl3 C A 9: 21,974,060 R658L possibly damaging Het
Rnf125 T A 18: 20,983,183 *141K probably null Het
Ros1 G T 10: 52,143,406 N711K probably damaging Het
Rsph10b T A 5: 143,959,686 Y421N probably benign Het
Ryr1 C T 7: 29,077,046 V2222I probably damaging Het
Samsn1 C T 16: 75,859,561 C333Y probably damaging Het
Stard9 A T 2: 120,703,019 E3252D possibly damaging Het
Syne1 C A 10: 5,173,008 R309S probably damaging Het
Syne1 T C 10: 5,222,289 I5051V probably benign Het
Syngap1 A G 17: 26,964,974 S1241G probably damaging Het
Tbpl2 T C 2: 24,076,018 K321R probably damaging Het
Tnrc18 C T 5: 142,731,352 G2449E probably damaging Het
Trim25 A G 11: 89,010,905 D342G probably benign Het
Tssk4 T A 14: 55,650,447 H33Q probably benign Het
Ttc3 G A 16: 94,467,972 G1971D possibly damaging Het
Tufm C T 7: 126,489,677 Q347* probably null Het
Ubxn10 G A 4: 138,720,822 S181F possibly damaging Het
Ushbp1 T C 8: 71,388,895 E430G probably benign Het
Vmn1r33 T C 6: 66,611,732 I279M possibly damaging Het
Vmn2r115 T C 17: 23,345,810 F224L probably damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps13a T C 19: 16,686,597 I1481V probably benign Het
Vps35 T C 8: 85,281,269 N294S possibly damaging Het
Washc3 A T 10: 88,216,054 T102S probably benign Het
Zfp27 T A 7: 29,895,934 E202V possibly damaging Het
Zfp58 T C 13: 67,491,916 H152R possibly damaging Het
Zfr2 T C 10: 81,244,662 V390A probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
putty UTSW 1 40742653 nonsense probably null
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7670:Slc9a2 UTSW 1 40718997 missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40726214 missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8887:Slc9a2 UTSW 1 40718849 missense probably benign 0.01
R9028:Slc9a2 UTSW 1 40726452 missense probably damaging 1.00
R9245:Slc9a2 UTSW 1 40766300 missense probably benign 0.27
R9250:Slc9a2 UTSW 1 40767827 missense probably benign 0.00
R9400:Slc9a2 UTSW 1 40719051 missense possibly damaging 0.65
R9512:Slc9a2 UTSW 1 40682098 missense probably damaging 0.98
R9583:Slc9a2 UTSW 1 40681901 missense probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTAGCAACAGTCTAGCTTTC -3'
(R):5'- GGACTTTAGCTGGCTTGGAC -3'

Sequencing Primer
(F):5'- AGCAACAGTCTAGCTTTCGTTGG -3'
(R):5'- CATGGAGTTATGAAGAGTCTGCCTCC -3'
Posted On 2022-02-07