Incidental Mutation 'R9189:Ryr1'
ID 697596
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms skrr, calcium release channel isoform 1, Ryr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9189 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 29003344-29125179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 29077046 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 2222 (V2222I)
Ref Sequence ENSEMBL: ENSMUSP00000149042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032813
AA Change: V2215I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: V2215I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179893
AA Change: V2215I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: V2215I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214374
AA Change: V2222I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T A 11: 116,174,405 D608V probably damaging Het
Actg1 A T 11: 120,348,187 C26S unknown Het
Ahnak T A 19: 9,010,883 V3177E possibly damaging Het
Akap11 G A 14: 78,513,498 T483I Het
Akr1cl A G 1: 65,024,671 S120P probably benign Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Ankrd55 A T 13: 112,368,036 I439F probably damaging Het
Asb8 A G 15: 98,142,754 M9T possibly damaging Het
Ascc1 A T 10: 60,007,823 Y69F probably benign Het
Atp9a A T 2: 168,676,140 probably null Het
Cd8b1 T C 6: 71,329,768 F160L probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cep250 A G 2: 155,976,430 T842A probably benign Het
Cgnl1 T A 9: 71,723,565 K552* probably null Het
Cntnap4 C T 8: 112,875,968 T1227M possibly damaging Het
Cobll1 C A 2: 65,150,989 V86F probably damaging Het
Dchs2 A G 3: 83,348,254 N2419S probably damaging Het
Dhx30 A T 9: 110,085,426 L1001* probably null Het
Diaph1 C T 18: 37,891,109 V559M unknown Het
Dis3l A T 9: 64,310,449 H783Q probably benign Het
Dock7 T G 4: 98,989,113 T1063P unknown Het
Dsc1 T C 18: 20,099,157 T265A possibly damaging Het
Eif2ak4 A T 2: 118,427,912 Q581L probably damaging Het
Eprs A T 1: 185,374,137 D183V possibly damaging Het
Fads2 G C 19: 10,091,819 D80E probably benign Het
Fam167b G A 4: 129,577,082 R158C probably damaging Het
Fam71a G A 1: 191,162,703 T581I possibly damaging Het
Flnb T A 14: 7,892,976 I682K possibly damaging Het
Gpatch2l C T 12: 86,244,378 P112S probably benign Het
Gpn1 T A 5: 31,497,366 H87Q unknown Het
Greb1l T C 18: 10,499,983 V350A probably benign Het
Grm5 A T 7: 88,074,816 K771N probably damaging Het
Gucy2c C T 6: 136,751,047 S319N probably benign Het
Hcfc2 G T 10: 82,699,207 A22S probably benign Het
Hist1h2bg A G 13: 23,571,587 D52G probably damaging Het
Hnf4a A G 2: 163,551,577 D39G probably benign Het
Il6st C T 13: 112,498,806 T584M probably damaging Het
Irf3 T A 7: 45,000,822 V254E possibly damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kank4 T A 4: 98,780,052 K53* probably null Het
Kcnj11 A T 7: 46,098,752 F382L possibly damaging Het
Kcnq3 T C 15: 65,995,661 Y711C probably damaging Het
Kctd3 A G 1: 188,972,439 S712P possibly damaging Het
Krt20 A G 11: 99,432,261 I245T possibly damaging Het
Larp1b T C 3: 40,970,604 I219T probably damaging Het
Lman2l A G 1: 36,439,690 F114L probably damaging Het
Loxl2 T A 14: 69,692,410 Y746N possibly damaging Het
Lrrc43 T C 5: 123,508,046 S628P probably benign Het
Mroh8 A C 2: 157,269,625 D136E probably damaging Het
Nek8 T A 11: 78,172,516 M141L probably benign Het
Nr2e1 C A 10: 42,578,272 R22L probably damaging Het
Nr6a1 C T 2: 38,926,117 probably null Het
Olfr1164 A G 2: 88,093,850 F29L probably damaging Het
Olfr1167 T C 2: 88,149,564 M152V probably benign Het
Olfr1377 T A 11: 50,985,339 C213S probably damaging Het
Olfr3 T A 2: 36,812,202 M297L possibly damaging Het
Onecut2 A G 18: 64,340,819 Y147C probably damaging Het
Pcdhac2 T C 18: 37,144,263 F99L probably benign Het
Pcdhga2 T G 18: 37,669,742 V213G possibly damaging Het
Pgap1 A T 1: 54,480,749 V909E probably benign Het
Pik3r4 A T 9: 105,669,839 T939S probably benign Het
Pip4k2c T C 10: 127,199,377 D374G possibly damaging Het
Plxdc1 A T 11: 97,953,962 D252E probably benign Het
Pm20d1 A C 1: 131,802,377 D218A probably damaging Het
Polq C A 16: 37,044,903 Q706K probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss41 A T 17: 23,842,387 H143Q probably damaging Het
Ptpn21 A G 12: 98,689,002 Y569H probably damaging Het
Rad17 T C 13: 100,637,056 K142E probably damaging Het
Rcan3 T C 4: 135,425,296 E38G probably benign Het
Rgl3 C A 9: 21,974,060 R658L possibly damaging Het
Rnf125 T A 18: 20,983,183 *141K probably null Het
Ros1 G T 10: 52,143,406 N711K probably damaging Het
Rsph10b T A 5: 143,959,686 Y421N probably benign Het
Samsn1 C T 16: 75,859,561 C333Y probably damaging Het
Slc9a2 G A 1: 40,755,784 E502K probably benign Het
Stard9 A T 2: 120,703,019 E3252D possibly damaging Het
Syne1 C A 10: 5,173,008 R309S probably damaging Het
Syne1 T C 10: 5,222,289 I5051V probably benign Het
Syngap1 A G 17: 26,964,974 S1241G probably damaging Het
Tbpl2 T C 2: 24,076,018 K321R probably damaging Het
Tnrc18 C T 5: 142,731,352 G2449E probably damaging Het
Trim25 A G 11: 89,010,905 D342G probably benign Het
Tssk4 T A 14: 55,650,447 H33Q probably benign Het
Ttc3 G A 16: 94,467,972 G1971D possibly damaging Het
Tufm C T 7: 126,489,677 Q347* probably null Het
Ubxn10 G A 4: 138,720,822 S181F possibly damaging Het
Ushbp1 T C 8: 71,388,895 E430G probably benign Het
Vmn1r33 T C 6: 66,611,732 I279M possibly damaging Het
Vmn2r115 T C 17: 23,345,810 F224L probably damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps13a T C 19: 16,686,597 I1481V probably benign Het
Vps35 T C 8: 85,281,269 N294S possibly damaging Het
Washc3 A T 10: 88,216,054 T102S probably benign Het
Zfp27 T A 7: 29,895,934 E202V possibly damaging Het
Zfp58 T C 13: 67,491,916 H152R possibly damaging Het
Zfr2 T C 10: 81,244,662 V390A probably damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29098785 missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29067630 missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29104832 missense probably benign 0.39
R7799:Ryr1 UTSW 7 29003560 splice site probably null
R7916:Ryr1 UTSW 7 29090939 nonsense probably null
R7922:Ryr1 UTSW 7 29097224 missense probably benign 0.09
R7988:Ryr1 UTSW 7 29096171 missense probably benign 0.29
R7997:Ryr1 UTSW 7 29003543 missense unknown
R8052:Ryr1 UTSW 7 29083385 missense probably benign 0.05
R8096:Ryr1 UTSW 7 29009201 missense unknown
R8116:Ryr1 UTSW 7 29110883 missense probably benign 0.03
R8202:Ryr1 UTSW 7 29091032 missense probably benign 0.18
R8207:Ryr1 UTSW 7 29090225 missense probably damaging 1.00
R8248:Ryr1 UTSW 7 29069121 missense probably damaging 1.00
R8257:Ryr1 UTSW 7 29064639 missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 29015717 missense unknown
R8454:Ryr1 UTSW 7 29015717 missense unknown
R8487:Ryr1 UTSW 7 29040867 missense probably damaging 0.97
R8529:Ryr1 UTSW 7 29070084 missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 29004814 unclassified probably benign
R8678:Ryr1 UTSW 7 29077064 missense probably damaging 0.99
R8717:Ryr1 UTSW 7 29052328 missense probably benign 0.03
R8724:Ryr1 UTSW 7 29117377 missense probably benign 0.04
R8755:Ryr1 UTSW 7 29092268 missense probably benign 0.19
R8772:Ryr1 UTSW 7 29116132 missense probably benign 0.05
R8790:Ryr1 UTSW 7 29076872 missense probably damaging 1.00
R8793:Ryr1 UTSW 7 29064859 missense probably damaging 1.00
R8836:Ryr1 UTSW 7 29074666 missense probably damaging 1.00
R8858:Ryr1 UTSW 7 29109213 missense probably benign 0.00
R8910:Ryr1 UTSW 7 29071915 missense probably damaging 1.00
R8920:Ryr1 UTSW 7 29090215 missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 29101933 missense probably damaging 1.00
R9035:Ryr1 UTSW 7 29090997 missense probably damaging 0.97
R9115:Ryr1 UTSW 7 29104564 nonsense probably null
R9123:Ryr1 UTSW 7 29071804 missense probably damaging 1.00
R9154:Ryr1 UTSW 7 29069858 missense probably benign 0.08
R9200:Ryr1 UTSW 7 29095099 missense probably benign 0.00
R9214:Ryr1 UTSW 7 29085762 missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 29101852 missense probably damaging 0.97
R9240:Ryr1 UTSW 7 29043888 missense probably damaging 1.00
R9261:Ryr1 UTSW 7 29052388 missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 29102829 missense probably damaging 0.99
R9280:Ryr1 UTSW 7 29102964 missense probably damaging 1.00
R9316:Ryr1 UTSW 7 29017962 missense unknown
R9333:Ryr1 UTSW 7 29074789 critical splice donor site probably null
R9459:Ryr1 UTSW 7 29068643 missense probably damaging 1.00
R9468:Ryr1 UTSW 7 29073085 missense probably damaging 1.00
R9486:Ryr1 UTSW 7 29078540 missense probably benign 0.15
R9524:Ryr1 UTSW 7 29024175 missense probably damaging 1.00
R9620:Ryr1 UTSW 7 29015713 missense unknown
R9664:Ryr1 UTSW 7 29059667 missense probably damaging 1.00
R9776:Ryr1 UTSW 7 29075239 missense probably damaging 1.00
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29020214 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29086035 missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29103498 missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29017985 missense unknown
Z1177:Ryr1 UTSW 7 29048792 nonsense probably null
Z1177:Ryr1 UTSW 7 29101922 missense probably damaging 1.00
Z1186:Ryr1 UTSW 7 29082477 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCAGGTGGTCAAACATGGAG -3'
(R):5'- GAGTGCAGACTGTTGTCACCATG -3'

Sequencing Primer
(F):5'- TCAAACATGGAGCGCTGGTTC -3'
(R):5'- ATGGTGACCATGAATCTCCCTGG -3'
Posted On 2022-02-07