Incidental Mutation 'R9189:Flnb'
ID 697634
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9189 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 7817957-7951588 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7892976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 682 (I682K)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect possibly damaging
Transcript: ENSMUST00000052678
AA Change: I682K

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: I682K

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T A 11: 116,174,405 D608V probably damaging Het
Actg1 A T 11: 120,348,187 C26S unknown Het
Ahnak T A 19: 9,010,883 V3177E possibly damaging Het
Akap11 G A 14: 78,513,498 T483I Het
Akr1cl A G 1: 65,024,671 S120P probably benign Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Ankrd55 A T 13: 112,368,036 I439F probably damaging Het
Asb8 A G 15: 98,142,754 M9T possibly damaging Het
Ascc1 A T 10: 60,007,823 Y69F probably benign Het
Atp9a A T 2: 168,676,140 probably null Het
Cd8b1 T C 6: 71,329,768 F160L probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cep250 A G 2: 155,976,430 T842A probably benign Het
Cgnl1 T A 9: 71,723,565 K552* probably null Het
Cntnap4 C T 8: 112,875,968 T1227M possibly damaging Het
Cobll1 C A 2: 65,150,989 V86F probably damaging Het
Dchs2 A G 3: 83,348,254 N2419S probably damaging Het
Dhx30 A T 9: 110,085,426 L1001* probably null Het
Diaph1 C T 18: 37,891,109 V559M unknown Het
Dis3l A T 9: 64,310,449 H783Q probably benign Het
Dock7 T G 4: 98,989,113 T1063P unknown Het
Dsc1 T C 18: 20,099,157 T265A possibly damaging Het
Eif2ak4 A T 2: 118,427,912 Q581L probably damaging Het
Eprs A T 1: 185,374,137 D183V possibly damaging Het
Fads2 G C 19: 10,091,819 D80E probably benign Het
Fam167b G A 4: 129,577,082 R158C probably damaging Het
Fam71a G A 1: 191,162,703 T581I possibly damaging Het
Gpatch2l C T 12: 86,244,378 P112S probably benign Het
Gpn1 T A 5: 31,497,366 H87Q unknown Het
Greb1l T C 18: 10,499,983 V350A probably benign Het
Grm5 A T 7: 88,074,816 K771N probably damaging Het
Gucy2c C T 6: 136,751,047 S319N probably benign Het
Hcfc2 G T 10: 82,699,207 A22S probably benign Het
Hist1h2bg A G 13: 23,571,587 D52G probably damaging Het
Hnf4a A G 2: 163,551,577 D39G probably benign Het
Il6st C T 13: 112,498,806 T584M probably damaging Het
Irf3 T A 7: 45,000,822 V254E possibly damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kank4 T A 4: 98,780,052 K53* probably null Het
Kcnj11 A T 7: 46,098,752 F382L possibly damaging Het
Kcnq3 T C 15: 65,995,661 Y711C probably damaging Het
Kctd3 A G 1: 188,972,439 S712P possibly damaging Het
Krt20 A G 11: 99,432,261 I245T possibly damaging Het
Larp1b T C 3: 40,970,604 I219T probably damaging Het
Lman2l A G 1: 36,439,690 F114L probably damaging Het
Loxl2 T A 14: 69,692,410 Y746N possibly damaging Het
Lrrc43 T C 5: 123,508,046 S628P probably benign Het
Mroh8 A C 2: 157,269,625 D136E probably damaging Het
Nek8 T A 11: 78,172,516 M141L probably benign Het
Nr2e1 C A 10: 42,578,272 R22L probably damaging Het
Nr6a1 C T 2: 38,926,117 probably null Het
Olfr1164 A G 2: 88,093,850 F29L probably damaging Het
Olfr1167 T C 2: 88,149,564 M152V probably benign Het
Olfr1377 T A 11: 50,985,339 C213S probably damaging Het
Olfr3 T A 2: 36,812,202 M297L possibly damaging Het
Onecut2 A G 18: 64,340,819 Y147C probably damaging Het
Pcdhac2 T C 18: 37,144,263 F99L probably benign Het
Pcdhga2 T G 18: 37,669,742 V213G possibly damaging Het
Pgap1 A T 1: 54,480,749 V909E probably benign Het
Pik3r4 A T 9: 105,669,839 T939S probably benign Het
Pip4k2c T C 10: 127,199,377 D374G possibly damaging Het
Plxdc1 A T 11: 97,953,962 D252E probably benign Het
Pm20d1 A C 1: 131,802,377 D218A probably damaging Het
Polq C A 16: 37,044,903 Q706K probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss41 A T 17: 23,842,387 H143Q probably damaging Het
Ptpn21 A G 12: 98,689,002 Y569H probably damaging Het
Rad17 T C 13: 100,637,056 K142E probably damaging Het
Rcan3 T C 4: 135,425,296 E38G probably benign Het
Rgl3 C A 9: 21,974,060 R658L possibly damaging Het
Rnf125 T A 18: 20,983,183 *141K probably null Het
Ros1 G T 10: 52,143,406 N711K probably damaging Het
Rsph10b T A 5: 143,959,686 Y421N probably benign Het
Ryr1 C T 7: 29,077,046 V2222I probably damaging Het
Samsn1 C T 16: 75,859,561 C333Y probably damaging Het
Slc9a2 G A 1: 40,755,784 E502K probably benign Het
Stard9 A T 2: 120,703,019 E3252D possibly damaging Het
Syne1 C A 10: 5,173,008 R309S probably damaging Het
Syne1 T C 10: 5,222,289 I5051V probably benign Het
Syngap1 A G 17: 26,964,974 S1241G probably damaging Het
Tbpl2 T C 2: 24,076,018 K321R probably damaging Het
Tnrc18 C T 5: 142,731,352 G2449E probably damaging Het
Trim25 A G 11: 89,010,905 D342G probably benign Het
Tssk4 T A 14: 55,650,447 H33Q probably benign Het
Ttc3 G A 16: 94,467,972 G1971D possibly damaging Het
Tufm C T 7: 126,489,677 Q347* probably null Het
Ubxn10 G A 4: 138,720,822 S181F possibly damaging Het
Ushbp1 T C 8: 71,388,895 E430G probably benign Het
Vmn1r33 T C 6: 66,611,732 I279M possibly damaging Het
Vmn2r115 T C 17: 23,345,810 F224L probably damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vps13a T C 19: 16,686,597 I1481V probably benign Het
Vps35 T C 8: 85,281,269 N294S possibly damaging Het
Washc3 A T 10: 88,216,054 T102S probably benign Het
Zfp27 T A 7: 29,895,934 E202V possibly damaging Het
Zfp58 T C 13: 67,491,916 H152R possibly damaging Het
Zfr2 T C 10: 81,244,662 V390A probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
R8976:Flnb UTSW 14 7901882 critical splice acceptor site probably null
R9055:Flnb UTSW 14 7908553 missense probably benign 0.00
R9148:Flnb UTSW 14 7817996 start gained probably benign
R9179:Flnb UTSW 14 7887541 nonsense probably null
R9180:Flnb UTSW 14 7818219 missense probably damaging 1.00
R9286:Flnb UTSW 14 7873414 missense probably damaging 0.98
R9288:Flnb UTSW 14 7904498 missense probably benign 0.43
R9354:Flnb UTSW 14 7818411 missense probably benign 0.13
R9484:Flnb UTSW 14 7929004 missense probably benign 0.06
R9505:Flnb UTSW 14 7904665 missense probably benign
R9525:Flnb UTSW 14 7905481 missense probably damaging 1.00
R9621:Flnb UTSW 14 7926421 missense probably damaging 0.99
R9630:Flnb UTSW 14 7926438 nonsense probably null
R9739:Flnb UTSW 14 7935954 nonsense probably null
R9760:Flnb UTSW 14 7929846 missense probably damaging 0.98
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTGGTGTTAAAATTTCAGCCG -3'
(R):5'- TGCTATTACTGCGCCCCATG -3'

Sequencing Primer
(F):5'- AACAGGCATTTTGTACACCTACTC -3'
(R):5'- ATTACTGCGCCCCATGTACAGG -3'
Posted On 2022-02-07