Incidental Mutation 'R9189:Flnb'
ID 697634
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 068951-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9189 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7892976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 682 (I682K)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect possibly damaging
Transcript: ENSMUST00000052678
AA Change: I682K

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: I682K

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T A 11: 116,065,231 (GRCm39) D608V probably damaging Het
Actg1 A T 11: 120,239,013 (GRCm39) C26S unknown Het
Ahnak T A 19: 8,988,247 (GRCm39) V3177E possibly damaging Het
Akap11 G A 14: 78,750,938 (GRCm39) T483I Het
Akr1cl A G 1: 65,063,830 (GRCm39) S120P probably benign Het
Ankle2 G A 5: 110,400,610 (GRCm39) V649M possibly damaging Het
Ankrd55 A T 13: 112,504,570 (GRCm39) I439F probably damaging Het
Asb8 A G 15: 98,040,635 (GRCm39) M9T possibly damaging Het
Ascc1 A T 10: 59,843,645 (GRCm39) Y69F probably benign Het
Atp9a A T 2: 168,518,060 (GRCm39) probably null Het
Cd8b1 T C 6: 71,306,752 (GRCm39) F160L probably benign Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Cep250 A G 2: 155,818,350 (GRCm39) T842A probably benign Het
Cgnl1 T A 9: 71,630,847 (GRCm39) K552* probably null Het
Cntnap4 C T 8: 113,602,600 (GRCm39) T1227M possibly damaging Het
Cobll1 C A 2: 64,981,333 (GRCm39) V86F probably damaging Het
Dchs2 A G 3: 83,255,561 (GRCm39) N2419S probably damaging Het
Dhx30 A T 9: 109,914,494 (GRCm39) L1001* probably null Het
Diaph1 C T 18: 38,024,162 (GRCm39) V559M unknown Het
Dis3l A T 9: 64,217,731 (GRCm39) H783Q probably benign Het
Dock7 T G 4: 98,877,350 (GRCm39) T1063P unknown Het
Dsc1 T C 18: 20,232,214 (GRCm39) T265A possibly damaging Het
Eif2ak4 A T 2: 118,258,393 (GRCm39) Q581L probably damaging Het
Eprs1 A T 1: 185,106,334 (GRCm39) D183V possibly damaging Het
Fads2 G C 19: 10,069,183 (GRCm39) D80E probably benign Het
Fam167b G A 4: 129,470,875 (GRCm39) R158C probably damaging Het
Garin4 G A 1: 190,894,900 (GRCm39) T581I possibly damaging Het
Gpatch2l C T 12: 86,291,152 (GRCm39) P112S probably benign Het
Gpn1 T A 5: 31,654,710 (GRCm39) H87Q unknown Het
Greb1l T C 18: 10,499,983 (GRCm39) V350A probably benign Het
Grm5 A T 7: 87,724,024 (GRCm39) K771N probably damaging Het
Gucy2c C T 6: 136,728,045 (GRCm39) S319N probably benign Het
H2bc8 A G 13: 23,755,761 (GRCm39) D52G probably damaging Het
Hcfc2 G T 10: 82,535,041 (GRCm39) A22S probably benign Het
Hnf4a A G 2: 163,393,497 (GRCm39) D39G probably benign Het
Il6st C T 13: 112,635,340 (GRCm39) T584M probably damaging Het
Irf3 T A 7: 44,650,246 (GRCm39) V254E possibly damaging Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Kank4 T A 4: 98,668,289 (GRCm39) K53* probably null Het
Kcnj11 A T 7: 45,748,176 (GRCm39) F382L possibly damaging Het
Kcnq3 T C 15: 65,867,510 (GRCm39) Y711C probably damaging Het
Kctd3 A G 1: 188,704,636 (GRCm39) S712P possibly damaging Het
Krt20 A G 11: 99,323,087 (GRCm39) I245T possibly damaging Het
Larp1b T C 3: 40,925,039 (GRCm39) I219T probably damaging Het
Lman2l A G 1: 36,478,771 (GRCm39) F114L probably damaging Het
Loxl2 T A 14: 69,929,859 (GRCm39) Y746N possibly damaging Het
Lrrc43 T C 5: 123,646,109 (GRCm39) S628P probably benign Het
Mroh8 A C 2: 157,111,545 (GRCm39) D136E probably damaging Het
Nek8 T A 11: 78,063,342 (GRCm39) M141L probably benign Het
Nr2e1 C A 10: 42,454,268 (GRCm39) R22L probably damaging Het
Nr6a1 C T 2: 38,816,129 (GRCm39) probably null Het
Onecut2 A G 18: 64,473,890 (GRCm39) Y147C probably damaging Het
Or1ad1 T A 11: 50,876,166 (GRCm39) C213S probably damaging Het
Or1j1 T A 2: 36,702,214 (GRCm39) M297L possibly damaging Het
Or5d37 A G 2: 87,924,194 (GRCm39) F29L probably damaging Het
Or5d39 T C 2: 87,979,908 (GRCm39) M152V probably benign Het
Pcdhac2 T C 18: 37,277,316 (GRCm39) F99L probably benign Het
Pcdhga2 T G 18: 37,802,795 (GRCm39) V213G possibly damaging Het
Pgap1 A T 1: 54,519,908 (GRCm39) V909E probably benign Het
Pik3r4 A T 9: 105,547,038 (GRCm39) T939S probably benign Het
Pip4k2c T C 10: 127,035,246 (GRCm39) D374G possibly damaging Het
Plxdc1 A T 11: 97,844,788 (GRCm39) D252E probably benign Het
Pm20d1 A C 1: 131,730,115 (GRCm39) D218A probably damaging Het
Polq C A 16: 36,865,265 (GRCm39) Q706K probably damaging Het
Pram1 A T 17: 33,860,131 (GRCm39) I233F probably benign Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Prss41 A T 17: 24,061,361 (GRCm39) H143Q probably damaging Het
Ptpn21 A G 12: 98,655,261 (GRCm39) Y569H probably damaging Het
Rad17 T C 13: 100,773,564 (GRCm39) K142E probably damaging Het
Rcan3 T C 4: 135,152,607 (GRCm39) E38G probably benign Het
Rgl3 C A 9: 21,885,356 (GRCm39) R658L possibly damaging Het
Rnf125 T A 18: 21,116,240 (GRCm39) *141K probably null Het
Ros1 G T 10: 52,019,502 (GRCm39) N711K probably damaging Het
Rsph10b T A 5: 143,896,504 (GRCm39) Y421N probably benign Het
Ryr1 C T 7: 28,776,471 (GRCm39) V2222I probably damaging Het
Samsn1 C T 16: 75,656,449 (GRCm39) C333Y probably damaging Het
Slc9a2 G A 1: 40,794,944 (GRCm39) E502K probably benign Het
Stard9 A T 2: 120,533,500 (GRCm39) E3252D possibly damaging Het
Syne1 C A 10: 5,123,008 (GRCm39) R309S probably damaging Het
Syne1 T C 10: 5,172,289 (GRCm39) I5051V probably benign Het
Syngap1 A G 17: 27,183,948 (GRCm39) S1241G probably damaging Het
Tbpl2 T C 2: 23,966,030 (GRCm39) K321R probably damaging Het
Tnrc18 C T 5: 142,717,107 (GRCm39) G2449E probably damaging Het
Trim25 A G 11: 88,901,731 (GRCm39) D342G probably benign Het
Tssk4 T A 14: 55,887,904 (GRCm39) H33Q probably benign Het
Ttc3 G A 16: 94,268,831 (GRCm39) G1971D possibly damaging Het
Tufm C T 7: 126,088,849 (GRCm39) Q347* probably null Het
Ubxn10 G A 4: 138,448,133 (GRCm39) S181F possibly damaging Het
Ushbp1 T C 8: 71,841,539 (GRCm39) E430G probably benign Het
Vmn1r33 T C 6: 66,588,716 (GRCm39) I279M possibly damaging Het
Vmn2r115 T C 17: 23,564,784 (GRCm39) F224L probably damaging Het
Vmn2r23 A T 6: 123,681,323 (GRCm39) H77L probably benign Het
Vps13a T C 19: 16,663,961 (GRCm39) I1481V probably benign Het
Vps35 T C 8: 86,007,898 (GRCm39) N294S possibly damaging Het
Washc3 A T 10: 88,051,916 (GRCm39) T102S probably benign Het
Zfp27 T A 7: 29,595,359 (GRCm39) E202V possibly damaging Het
Zfp58 T C 13: 67,640,035 (GRCm39) H152R possibly damaging Het
Zfr2 T C 10: 81,080,496 (GRCm39) V390A probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTGGTGTTAAAATTTCAGCCG -3'
(R):5'- TGCTATTACTGCGCCCCATG -3'

Sequencing Primer
(F):5'- AACAGGCATTTTGTACACCTACTC -3'
(R):5'- ATTACTGCGCCCCATGTACAGG -3'
Posted On 2022-02-07